Gene Rv0191
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Unknown; possibly involved in transport of drug across the membrane. |
Product | Probable conserved integral membrane protein |
Comments | Rv0191, (MTCI28.30), len: 413 aa. Probable conserved integral membrane protein, member of major facilitator superfamily (MFS) possibly involved in transport of drug, similar to several hypothetical proteins e.g. YDEA_ECOLI|P31122 hypothetical 42.5 kd protein from Escherichia coli (396 aa), FASTA scores: opt: 475, E(): 4.2e-33, (29.7% identity in 381 aa overlap); and to several chloramphenicol resistance proteins e.g. CMLR_STRLI|P31141 chloramphenicol resistance protein from Streptomyces lividans (392 aa), FASTA scores: opt: 394, E(): 6.7e-12, (28.2% identity in 383 aa overlap). Also similar to SVU09991_1 from Mycobacterium tuberculosis. |
Functional category | Cell wall and cell processes |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene provides a growth advantage for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 222289 | 223530 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0191|222289-223530|+|Rv0191|downstream:0|upstream:0 atgactgccccaaccggaacctccgccactacgacgcgaccgtggacgccacggatcgccacgcaactgtccgtgctggcttgcgcggcctttatctatgtcaccgccgaaatcctgccagtgggcgcgctgtcggcgatagcgcggaacttgcgcgtcagcgtggtcctagttgggaccttgctgtcctggtatgcccttgtcgcggccgtgacaacggttccgctggtgcgttggaccgcacactggccgcgccgccgggccctggtggtcagcctggtctgcctgaccgtctcgcaactcgtctcggcgctggcgcccaacttcgcggtgctggccgccgggcgggtgctctgcgcggtcacccatggcctgctgtgggcggtcatcgcgccgatcgccacccggctggtgccgcccagtcacgccgggcgcgccacgacgtcgatctacatcggaaccagtctggcgctggtcgtcggtagcccactcacggctgccatgagcctgatgtggggttggcggctggcggcggtgtgcgtgaccggcgcggcggccgcggtcgccctggccgcccggctggcgttgccggagatggtgctgcgcgccgaccagctcgagcacgttggccgacgggctcgtcaccaccgtaatcctcgcctggtcaaggtcagtgtgctcacgatgatcgcggtaaccggccatttcgtgtcctacacctacatcgtggtgatcatccgcgacgtcgtcggtgtacgtgggccgaatctggcctggctgctcgccgcctatggggtcgccggcctggtgtccgtgcccctggtggcgcggccgttggaccgttggcccaagggcgccgtcatcgtcggtatgaccggactgacggcggcgttcaccttgctgaccgcgctggcattcggtgaacgccacaccgcggcgacggcactgctgggcaccggtgcgattgtgctgtggggagccttggccactgccgtgtcaccgatgctgcaatcggcggcgatgcgtagcggcggcgacgaccccgacggggcctcaggtttgtatgtgacggcgtttcagatcggcatcatggccggcgctctgctgggtgggctgctctacgagcgcagcttggcgatgatgctgaccgcgtcggcgggtttgatgggtgttgcgttgttcgggatgacggttagccagcacttgttcgagaatccgactctgagtcccggcgacggctaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0191|Rv0191 MTAPTGTSATTTRPWTPRIATQLSVLACAAFIYVTAEILPVGALSAIARNLRVSVVLVGTLLSWYALVAAVTTVPLVRWTAHWPRRRALVVSLVCLTVSQLVSALAPNFAVLAAGRVLCAVTHGLLWAVIAPIATRLVPPSHAGRATTSIYIGTSLALVVGSPLTAAMSLMWGWRLAAVCVTGAAAAVALAARLALPEMVLRADQLEHVGRRARHHRNPRLVKVSVLTMIAVTGHFVSYTYIVVIIRDVVGVRGPNLAWLLAAYGVAGLVSVPLVARPLDRWPKGAVIVGMTGLTAAFTLLTALAFGERHTAATALLGTGAIVLWGALATAVSPMLQSAAMRSGGDDPDGASGLYVTAFQIGIMAGALLGGLLYERSLAMMLTASAGLMGVALFGMTVSQHLFENPTLSPGDG
Bibliography
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant