Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionUnknown; possibly involved in transport of drug across the membrane.
ProductProbable conserved integral membrane protein
CommentsRv0191, (MTCI28.30), len: 413 aa. Probable conserved integral membrane protein, member of major facilitator superfamily (MFS) possibly involved in transport of drug, similar to several hypothetical proteins e.g. YDEA_ECOLI|P31122 hypothetical 42.5 kd protein from Escherichia coli (396 aa), FASTA scores: opt: 475, E(): 4.2e-33, (29.7% identity in 381 aa overlap); and to several chloramphenicol resistance proteins e.g. CMLR_STRLI|P31141 chloramphenicol resistance protein from Streptomyces lividans (392 aa), FASTA scores: opt: 394, E(): 6.7e-12, (28.2% identity in 383 aa overlap). Also similar to SVU09991_1 from Mycobacterium tuberculosis.
Functional categoryCell wall and cell processes
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene provides a growth advantage for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS222289223530+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0191|222289-223530|+|Rv0191|downstream:0|upstream:0
atgactgccccaaccggaacctccgccactacgacgcgaccgtggacgccacggatcgccacgcaactgtccgtgctggcttgcgcggcctttatctatgtcaccgccgaaatcctgccagtgggcgcgctgtcggcgatagcgcggaacttgcgcgtcagcgtggtcctagttgggaccttgctgtcctggtatgcccttgtcgcggccgtgacaacggttccgctggtgcgttggaccgcacactggccgcgccgccgggccctggtggtcagcctggtctgcctgaccgtctcgcaactcgtctcggcgctggcgcccaacttcgcggtgctggccgccgggcgggtgctctgcgcggtcacccatggcctgctgtgggcggtcatcgcgccgatcgccacccggctggtgccgcccagtcacgccgggcgcgccacgacgtcgatctacatcggaaccagtctggcgctggtcgtcggtagcccactcacggctgccatgagcctgatgtggggttggcggctggcggcggtgtgcgtgaccggcgcggcggccgcggtcgccctggccgcccggctggcgttgccggagatggtgctgcgcgccgaccagctcgagcacgttggccgacgggctcgtcaccaccgtaatcctcgcctggtcaaggtcagtgtgctcacgatgatcgcggtaaccggccatttcgtgtcctacacctacatcgtggtgatcatccgcgacgtcgtcggtgtacgtgggccgaatctggcctggctgctcgccgcctatggggtcgccggcctggtgtccgtgcccctggtggcgcggccgttggaccgttggcccaagggcgccgtcatcgtcggtatgaccggactgacggcggcgttcaccttgctgaccgcgctggcattcggtgaacgccacaccgcggcgacggcactgctgggcaccggtgcgattgtgctgtggggagccttggccactgccgtgtcaccgatgctgcaatcggcggcgatgcgtagcggcggcgacgaccccgacggggcctcaggtttgtatgtgacggcgtttcagatcggcatcatggccggcgctctgctgggtgggctgctctacgagcgcagcttggcgatgatgctgaccgcgtcggcgggtttgatgggtgttgcgttgttcgggatgacggttagccagcacttgttcgagaatccgactctgagtcccggcgacggctaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0191|Rv0191
MTAPTGTSATTTRPWTPRIATQLSVLACAAFIYVTAEILPVGALSAIARNLRVSVVLVGTLLSWYALVAAVTTVPLVRWTAHWPRRRALVVSLVCLTVSQLVSALAPNFAVLAAGRVLCAVTHGLLWAVIAPIATRLVPPSHAGRATTSIYIGTSLALVVGSPLTAAMSLMWGWRLAAVCVTGAAAAVALAARLALPEMVLRADQLEHVGRRARHHRNPRLVKVSVLTMIAVTGHFVSYTYIVVIIRDVVGVRGPNLAWLLAAYGVAGLVSVPLVARPLDRWPKGAVIVGMTGLTAAFTLLTALAFGERHTAATALLGTGAIVLWGALATAVSPMLQSAAMRSGGDDPDGASGLYVTAFQIGIMAGALLGGLLYERSLAMMLTASAGLMGVALFGMTVSQHLFENPTLSPGDG