Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionFunction unknown
ProductPPE family protein PPE24
CommentsRv1753c, (MTCY28.16c), len: 1053 aa. PPE24, Member of the Mycobacterium tuberculosis PPE family of Gly-, Asn-rich proteins, similar to many e.g. YF48_MYCTU|Q10778 hypothetical protein cy48.17 (678 aa), FASTA scores: opt: 1360, E(): 0, (48.9% identity in 550 aa overlap). Note that the Gly-, Asn-rich sequence is interrupted by six near-perfect 26 aa repeats, a unique region, and another, more degenerate region of five 25 aa repeats before resuming at the C-terminus. The end of the first Gly-, Asn- rich region and the start of the first set of repeats shows some similarity to Q50577|AT10S from Mycobacterium tuberculosis (170 aa) (40.2% identity in 189 aa overlap).
Functional categoryPe/ppe
ProteomicsIdentified by mass spectrometry in M. tuberculosis H37Rv-infected guinea pig lungs at 90 days but not 30 days (See Kruh et al., 2010).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv and CDC1551 strains (see Sassetti et al., 2003 and Lamichhane et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS19816141984775-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv1753c|1981614-1984775|-|PPE24|downstream:0|upstream:0
atgaatttttctgtactgccgccggagatcaattcagcgctgatattcgccggggcagggccggaaccgatggcggcggccgcgacggcctgggacgggttggccatggaattggcctcggccgcagcctctttcggctcagtgacatccggactcgtgggcggggcgtggcagggcgcgtcgtcgtcggcgatggcggcagcggcagccccctatgcggcgtggcttgccgcggcggcggtccaggccgagcagacggccgctcaggctgcggcgatgatagccgagtttgaagcggtcaagacggcggtggtgcagccgatgctggtggcggccaaccgtgccgacctggtgtcgctggtgatgtcgaacctgtttggacagaacgctccggcgatcgctgccattgaagccacgtacgagcaaatgtgggctgccgatgtgtcggcgatgtctgcctaccatgccggggcatcggcgatcgcctcggcgctgtccccgttcagtaaaccgctgcagaacctggctggcttgccggcttggttggccagcggcgcgcctgcggccgccatgaccgcagccgcaggcataccggcgcttgcgggcggacccaccgccatcaacctgggcatagccaacgtcggcggtggcaacgtcggcaacgccaacaacggccttgccaacatcggcaacgccaaccttggcaactacaatttcgggtccggaaatttcggtaactccaatatcggctcagcaagcctgggtaataacaacatcggcttcgggaacctcggcagcaacaatgtcggcgtgggaaaccttggcaatctcaacaccgggtttgccaacaccggcttgggcaacttcggctttggcaacactggcaacaacaacatcggcatcggtcttaccggcaacaaccagatcggaatcggcgggctcaactcgggcaccgggaatttcggattgttcaactcgggcagcggaaacgtcggcttcttcaactccggcaatggaaactttggcatcggaaactcgggtaatttcaacaccggtggctggaattctggacacgggaacacgggcttcttcaatgcgggctcgtttaacaccggtatgttggacgtcggcaacgcgaacacaggcagcctgaacaccggcagttataacatgggcgacttcaatccggggtcgtccaacaccggcacgttcaacacgggaaatgctaacacgggtttcctcaacgccggaaatatcaacactggtgtcttcaatattggccacatgaataatgggctgttcaacacgggtgacatgaacaatggcgtcttctaccggggcgtggggcagggcagcctgcagttcagtattacgacacctgatctgactctgccgccgctgcaaataccggggatatcggttcccgccttcagtctgccggcaataacgctgccgtcgctgaacatcccggccgccaccacaccggccaacatcaccgtcggcgccttcagcctgcccgggttgacgttgccgtcgttgaacatcccggccgccaccacaccagccaacatcaccgtgggtgccttcagcctgcccgggttgacgttgccgtcgttgaacatcccggccgccaccacaccagccaacatcaccgtcggcgccttcagcctgcccgggttgacgttgccgtcgttgaacatcccggccgccaccacaccagccaacatcaccgtcggcgccttcagcctgcccgggttgacgttgccgtcgttgaacatcccggccgccaccacaccagccaacatcaccgtcggcgccttcagcctgcccgggttgacgttgccgtcgttgaacatcccggccgccaccacacccgccaacatcaccgtaagcggctttcagttgcctccgctgagtattccttccgtagccattccgccggtgacggtcccgcccattacggtgggtgcttttaatttgccgccattgcagattccggaagtaactattccgcagctgacgatacccgcgggtatcacaatcggtggctttagtctacctgcgatacatactcaaccgataacggtcggccagattggcgtgggccaatttggcctgccctccataggctgggatgttttcctaagcacacctaggataacagtaccggcttttggaataccctttaccctacaattccagaccaatgtgcctgcgcttcagccgcccggcggcgggcttagtactttcaccaatggcgccctcatcttcggtgagtttgacttaccacaattggtggttcacccatacacattgaccggccctattgtcatcggttcattctttctgcccgccttcaacatacccgggatcgatgtccccgctatcaacgtcgatggcttcaccctgccgcagatcaccaccccagctatcaccaccccggagttcgcgatccctccgatcggcgtgggcggcttcactctgccgcagatcaccacccaggaaatcatcaccccggagctaaccatcaactcgatcggcgtcggcgggttcaccctgccgcaaatcaccaccccacccatcaccaccccaccgctgaccatcgaccccatcaacctcaccggcttcaccctcccccaaatcaccaccccacccatcaccaccccaccgctgaccatcgaccccatcaacctcaccggcttcaccctcccccaaatcaccaccccacccatcaccaccccaccgctcaccatcgagccgatcggcgtggggggcttcaccacgcccccgctcaccgttcccggcatccacctgcccagcaccacgatcggggccttcgcgatccccggggggccgggctacttcaactcgagcaccgcgccttcgtcgggcttcttcaattccggtgcgggcggcaactcgggcttcggcaacaacggctcgggcctctcgggttggttcaacaccaacccggccgggctgttgggcggctcgggctatcagaacttcggcgggctatcctcgggcttttccaaccttggcagcggcgtctcaggcttcgccaacaggggcatcctgccgttctcggtagccagcgtcgtttccggctttgccaatatcggcaccaacctggcgggtttcttccaaggcaccacgtcctaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv1753c|PPE24
MNFSVLPPEINSALIFAGAGPEPMAAAATAWDGLAMELASAAASFGSVTSGLVGGAWQGASSSAMAAAAAPYAAWLAAAAVQAEQTAAQAAAMIAEFEAVKTAVVQPMLVAANRADLVSLVMSNLFGQNAPAIAAIEATYEQMWAADVSAMSAYHAGASAIASALSPFSKPLQNLAGLPAWLASGAPAAAMTAAAGIPALAGGPTAINLGIANVGGGNVGNANNGLANIGNANLGNYNFGSGNFGNSNIGSASLGNNNIGFGNLGSNNVGVGNLGNLNTGFANTGLGNFGFGNTGNNNIGIGLTGNNQIGIGGLNSGTGNFGLFNSGSGNVGFFNSGNGNFGIGNSGNFNTGGWNSGHGNTGFFNAGSFNTGMLDVGNANTGSLNTGSYNMGDFNPGSSNTGTFNTGNANTGFLNAGNINTGVFNIGHMNNGLFNTGDMNNGVFYRGVGQGSLQFSITTPDLTLPPLQIPGISVPAFSLPAITLPSLNIPAATTPANITVGAFSLPGLTLPSLNIPAATTPANITVGAFSLPGLTLPSLNIPAATTPANITVGAFSLPGLTLPSLNIPAATTPANITVGAFSLPGLTLPSLNIPAATTPANITVGAFSLPGLTLPSLNIPAATTPANITVSGFQLPPLSIPSVAIPPVTVPPITVGAFNLPPLQIPEVTIPQLTIPAGITIGGFSLPAIHTQPITVGQIGVGQFGLPSIGWDVFLSTPRITVPAFGIPFTLQFQTNVPALQPPGGGLSTFTNGALIFGEFDLPQLVVHPYTLTGPIVIGSFFLPAFNIPGIDVPAINVDGFTLPQITTPAITTPEFAIPPIGVGGFTLPQITTQEIITPELTINSIGVGGFTLPQITTPPITTPPLTIDPINLTGFTLPQITTPPITTPPLTIDPINLTGFTLPQITTPPITTPPLTIEPIGVGGFTTPPLTVPGIHLPSTTIGAFAIPGGPGYFNSSTAPSSGFFNSGAGGNSGFGNNGSGLSGWFNTNPAGLLGGSGYQNFGGLSSGFSNLGSGVSGFANRGILPFSVASVVSGFANIGTNLAGFFQGTTS