Gene Rv1925
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown, but involvement in lipid degradation. |
Product | Probable acyl-CoA ligase FadD31 (acyl-CoA synthetase) (acyl-CoA synthase) |
Comments | Rv1925, (MTCY09F9.39c), len: 620 aa. Probable fadD31, acyl-CoA synthetase, highly similar to others from Mycobacterium leprae e.g. NP_301198.1|NC_002677 putative acyl-CoA synthetase (635 aa); NP_302537.1|NC_002677 probable acyl-CoA synthase (583 aa); etc. Also highly similar to others from Mycobacterium tuberculosis e.g. fadD32 (637 aa); fadD21 (578 aa); fadD29 (619 aa); fadD26|FD26_MYCTU|Q10976 (626 aa), FASTA scores: opt: 945, E(): 0, (39.8% identity in 598 aa overlap); etc. Also similar to N-terminus of G1171128 saframycin MX1 synthetase B from Myxococcus xanthus (1770 aa), FASTA scores: opt: 845, E(): 0, (37.4% identity in 593 aa overlap); N-terminus of T34918 polyketide synthase from Streptomyces coelicolor (2297 aa); etc. Nucleotide position 2177654 in the genome sequence has been corrected, A:C resulting in M190L. |
Functional category | Lipid metabolism |
Proteomics | Identified by proteomics at the Statens Serum Institute (Denmark) (See Rosenkrands et al., 2000). Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the cell wall and cell membrane fractions of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified in the membrane fraction of M. tuberculosis H37Rv using nanoLC-MS/MS (See Xiong et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene provides a growth advantage for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 2177087 | 2178949 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv1925|2177087-2178949|+|fadD31|downstream:0|upstream:0 atgaatgacggctcccggcaggaactcagggttcgtagcggcctactacaaatcgaggactgcctggatgctgacggcggcatcgcattgccggcaggcaccacgctgatctcgctcatcgagcgcaacatcaagtatgtcggcgacctcgtggcgtatcgctacctggaccacgcccgttcggccgccggatgcgccctggaagtgacctggacgcaattcggtatgcgattagcggccataggtgcacacgtgcaacggttcgcaggccccggcgaccgcgttgcgatcctcgcaccacagggcatcgactatgtttgcgggttctacgctgcaatcaaggcaggcaccgtcgcggtgccgttgttcgcacccgaactgccgggtcacgccgagcgtcttgatacggcacttcgcgattcggagccagcggtcatactcacgacggcggcggcgaaaaacgccgttgaaggttttctgaacaacgttccgcgcctgcgaaagccgacagtcctcgtcatcgatcaaatacccgaccgcgagggggagctgttcgtcccggtcgagctggacatcgacgccgtatcccacctgcagtacacctcgggctcgacgcgacccccggtcggtgtcgagatcacccaccgcgcggtcggcaccaacctggtgcaaatgatcctgtcgatcgacctgctcaaccgaaacacccacggcgtcagttggttaccgctgtaccacgacatgggcctatccatgatcggctttccggcggtctatggcggacactccaccctgatgtcgcccacggcgtttgtccgcaggccactgcgatggatccaggcgttgtccgaggggtcgcggaccggacgcgtggtcaccgcggcgccaaacttcgcctacgagtgggccgcacagcgtggactacccgcgcaaggcgacgacgtcgacctcagcaatgtcgtgctgatcatcggttccgaaccagtcagcatcgatgcggtgaccacgttcaacaaagcgttcgcgccctatggtttaccgcgtacagcgttcaaaccctcgtacggcatagccgaggcgaccctgctcgtcgcgaccatcgaccatgccgctgagccgacggttgtttatcttgacccagagcagttgggcgccggacacgcgacgcgcgtcgcgccggatgcgcccaacgccgtcgtgcacgtgtcgtgtggccatgtggcccgcagcctgtgggccgtgatcgtcgacccggataccggccccgaggcgggcgccgaactgcccgacggtgagatcggtgaggtttggttacaaggcgacaacgttgctcgggggtattggggacggccggaagaaacgcggatgacgttcggtgcccgcttgcaatcaccgctcgccgaaggcagccacgccgacgggtccgcgatcgacgacacctggctgcgcaccggagacctcggcgtgtacctcgacggtgagctctacatcaccggtcgaatcgcggatctgctgaccatcgacggccgcaaccactatccgcaggacatcgaggccacggccgccgaggcctcgccgatggtgcggcgcggatacataaccgctttcacggtgccggccagcgacggggacgaccgcaatcagcgactggtgatcatcgccgaacgtgcggcaggcaccagtcgcagcgacccgcggccggcgctcgacgcgattcgcgcagcggtttgcaaccgccacgggttatccgttgcggacctgagtttcctgccggccggcgccattccacgcaccaccagcgggaagctggctcgccaggcctgccgcgcccaatacctcagcggtcgcctgggcgtgcattag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv1925|fadD31 MNDGSRQELRVRSGLLQIEDCLDADGGIALPAGTTLISLIERNIKYVGDLVAYRYLDHARSAAGCALEVTWTQFGMRLAAIGAHVQRFAGPGDRVAILAPQGIDYVCGFYAAIKAGTVAVPLFAPELPGHAERLDTALRDSEPAVILTTAAAKNAVEGFLNNVPRLRKPTVLVIDQIPDREGELFVPVELDIDAVSHLQYTSGSTRPPVGVEITHRAVGTNLVQMILSIDLLNRNTHGVSWLPLYHDMGLSMIGFPAVYGGHSTLMSPTAFVRRPLRWIQALSEGSRTGRVVTAAPNFAYEWAAQRGLPAQGDDVDLSNVVLIIGSEPVSIDAVTTFNKAFAPYGLPRTAFKPSYGIAEATLLVATIDHAAEPTVVYLDPEQLGAGHATRVAPDAPNAVVHVSCGHVARSLWAVIVDPDTGPEAGAELPDGEIGEVWLQGDNVARGYWGRPEETRMTFGARLQSPLAEGSHADGSAIDDTWLRTGDLGVYLDGELYITGRIADLLTIDGRNHYPQDIEATAAEASPMVRRGYITAFTVPASDGDDRNQRLVIIAERAAGTSRSDPRPALDAIRAAVCNRHGLSVADLSFLPAGAIPRTTSGKLARQACRAQYLSGRLGVH
Bibliography
- Rosenkrands I et al. [2000]. Towards the proteome of Mycobacterium tuberculosis. Proteomics
- Gu S et al. [2003]. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Proteomics
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Xiong Y, Chalmers MJ, Gao FP, Cross TA and Marshall AG [2005]. Identification of Mycobacterium tuberculosis H37Rv integral membrane proteins by one-dimensional gel electrophoresis and liquid chromatography electrospray ionization tandem mass spectrometry. Proteomics
- Niemann S, Koser CU, Gagneux S, Plinke C, Homolka S, Bignell H, Carter RJ, Cheetham RK, Cox A, Gormley NA, Kokko-Gonzales P, Murray LJ, Rigatti R, Smith VP, Arends FP, Cox HS, Smith G and Archer JA [2009]. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints. Sequence
- Ioerger TR et al. [2010]. Variation among genome sequences of H37Rv strains of Mycobacterium tuberculosis from multiple laboratories. Sequence
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant