Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionHas helicase activity.
ProductProbable helicase HelZ
CommentsRv2101, (MTV020.01), len: 1013 aa. Probable helZ, helicase, similar to many. Nucleotide position 2361623 in the genome sequence has been corrected, A:C resulting in M462L.
Functional categoryInformation pathways
ProteomicsIdentified in the cytosol, cell wall, and cell membrane fractions of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Found to be deleted (partially or completely) in one or more clinical isolates (See Tsolaki et al., 2004).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS23602402363281+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2101|2360240-2363281|+|helZ|downstream:0|upstream:0
atgctggttttgcacggcttctggtccaactccggcgggatgcggctgtgggcggaggactccgatctgctggtgaagagcccgagtcaggcgctgcgctccgcgcggccacacccgttcgcggcgcccgctgacctgatcgccggcatacatccgggcaaacccgcaaccgccgttttgctgttgccgtcgttgcgatcggcgccgctggactcgccggagctgatccggctcgccccgcgcccggccgcgcgaaccgatccgatgctgttggcgtggacggtaccggtggtggacctggaccccaccgcggcgttggccgccttcgaccagcccgcccccgacgtccgctacggcgcgtccgtcgactacctggccgagctggccgttttcgcgcgcgagttggtcgagcgtggtcgcgtgctgccccagctgcgccgcgacacccacggcgcggccgcctgctggcgtccggtgttgcagggacgcgacgtggtcgcgatgacctcgctggtctcggcgatgccgccggtctgccgcgccgaagttggtgggcacgacccgcacgaactggcaacctcggctctggacgcgatggtcgacgccgccgtgcgcgcggcgctgtcaccgatggacctgctgcccccgcgacggggtcgctccaaacggcatcgggccgtggaggcttggctgaccgcgttgacctgcccggacggccggttcgacgcggagcccgacgaactcgacgcgctggccgaggcgttgcggccatgggacgacgtcggtatcggcaccgtcggcccggcgcgggcgacgtttcggctgtccgaagtcgagaccgaaaacgaggagacgcccgcgggctcgttgtggaggctggagttcttattgcagtcgacgcaggaccccagcctgctggtccccgccgagcaggcatggaacgacgacggcagcctgcgccgctggctggaccggccgcaggagctgctgctgaccgaactgggccgggcctctcggattttccccgagctcgtcccggcgctgcgcaccgcgtgcccgtccgggcttgagctcgacgccgacggcgcctaccgattcctgtcgggtacggccgcggtgctcgacgaggctgggtttggcgtgctgctgccgtcctggtgggaccgccgccgcaagctgggcttggtcctgtccgcatataccccggtcgacggcgtggtgggcaaggccagcaagttcggccgcgagcagctcgtcgagttccgctgggagctggccgtgggcgacgatccgctcagcgaggaggagatcgcggcgctgaccgaaaccaagtccccgctgatccggctgcgtggccagtgggtcgcgctcgataccgaacagctgcgccgcgggctggagtttttggagcgtaagccaaccggccgcaagaccaccgccgagatcctcgcgctggccgccagccaccccgacgacgtggacaccccgctcgaggtcaccgccgtacgcgccgacggctggctcggggacctgctcgccggggccgccgcggcgtcgctgcagccgttggacccgcccgacggattcaccgcgacgctgcgtccctaccagcagcgcggtctggcgtggctggcgtttttgtcctcgctcggtttgggcagctgcctggccgacgacatgggcctgggcaagacggtgcagctattggccctggaaaccttggaatccgttcagcgccaccaggatcgcggcgtcggacccacactgctactgtgcccgatgtcgttggtgggcaactggccgcaggaagcggccaggtttgcacccaacctgcgggtgtacgcccaccacgggggcgcccggctgcacggcgaggcgttgcgcgaccacctcgagcgcaccgacctggtcgtgagcacctataccaccgccacccgcgacatcgacgagctggcggaatacgaatggaaccgggtggtgctggacgaggcccaggcggtgaagaacagcctgtcccgggcggccaaggcggtgcgacggctacgcgcggcgcaccgggtcgcgctgaccgggacaccgatggagaaccggctcgccgagctgtggtcgatcatggacttcctcaacccgggcctgctcggatcctccgaacgcttccgcacccgctacgcgatcccgatcgagcggcacgggcacaccgaaccggccgaacggctgcgcgcatcgacgcggccctacatcctgcgccggctcaagaccgacccggcgatcatcgacgatctgccggagaagatcgagatcaagcagtactgccaactcaccaccgagcaggcgtcgctgtatcaggccgtcgtcgccgacatgatggaaaagatcgaaaacaccgaagggatcgagcggcgcggcaacgtgctggccgcgatggccaagctcaaacaggtgtgcaaccaccccgcccagctgctgcacgatcgctccccggtcggtcggcggtccgggaaggtgatccggctcgaggagatcctggaagagatcctggccgagggcgaccgggtgctgtgttttacccagttcaccgagttcgccgagctgctggtgccgcacctggccgcacgcttcggccgtgccgcccgagacattgcctacctgcacggtggcaccccgaggaagcggcgtgacgagatggtggcccggttccagtccggtgacggcccgcccatttttctgctgtcgttgaaggcgggcggtaccgggctgaacctcaccgccgccaatcatgttgtgcacctggaccgctggtggaacccggcggtcgagaaccaggcgacggaccgggcgtttcggatcgggcagcggcgcacggtgcaggtccgcaagttcatctgcaccggcaccctcgaggagaagatcgacgaaatgatcgaggagaaaaaggcgctggccgacttggtggtcaccgacggcgaaggctggctgaccgaactgtccacccgcgatctgcgcgaggtgttcgcgctgtccgaaggcgccgtcggtgagtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2101|helZ
MLVLHGFWSNSGGMRLWAEDSDLLVKSPSQALRSARPHPFAAPADLIAGIHPGKPATAVLLLPSLRSAPLDSPELIRLAPRPAARTDPMLLAWTVPVVDLDPTAALAAFDQPAPDVRYGASVDYLAELAVFARELVERGRVLPQLRRDTHGAAACWRPVLQGRDVVAMTSLVSAMPPVCRAEVGGHDPHELATSALDAMVDAAVRAALSPMDLLPPRRGRSKRHRAVEAWLTALTCPDGRFDAEPDELDALAEALRPWDDVGIGTVGPARATFRLSEVETENEETPAGSLWRLEFLLQSTQDPSLLVPAEQAWNDDGSLRRWLDRPQELLLTELGRASRIFPELVPALRTACPSGLELDADGAYRFLSGTAAVLDEAGFGVLLPSWWDRRRKLGLVLSAYTPVDGVVGKASKFGREQLVEFRWELAVGDDPLSEEEIAALTETKSPLIRLRGQWVALDTEQLRRGLEFLERKPTGRKTTAEILALAASHPDDVDTPLEVTAVRADGWLGDLLAGAAAASLQPLDPPDGFTATLRPYQQRGLAWLAFLSSLGLGSCLADDMGLGKTVQLLALETLESVQRHQDRGVGPTLLLCPMSLVGNWPQEAARFAPNLRVYAHHGGARLHGEALRDHLERTDLVVSTYTTATRDIDELAEYEWNRVVLDEAQAVKNSLSRAAKAVRRLRAAHRVALTGTPMENRLAELWSIMDFLNPGLLGSSERFRTRYAIPIERHGHTEPAERLRASTRPYILRRLKTDPAIIDDLPEKIEIKQYCQLTTEQASLYQAVVADMMEKIENTEGIERRGNVLAAMAKLKQVCNHPAQLLHDRSPVGRRSGKVIRLEEILEEILAEGDRVLCFTQFTEFAELLVPHLAARFGRAARDIAYLHGGTPRKRRDEMVARFQSGDGPPIFLLSLKAGGTGLNLTAANHVVHLDRWWNPAVENQATDRAFRIGQRRTVQVRKFICTGTLEEKIDEMIEEKKALADLVVTDGEGWLTELSTRDLREVFALSEGAVGE
      
Bibliography