Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionThought to be involved in active transport of undetermined substrate (possibly iron) across the membrane. Responsible for energy coupling to the transport system.
ProductProbable conserved ATP-binding protein ABC transporter
CommentsRv3041c, (MTV012.56c), len: 287 aa. Probable conserved ATP-binding protein ABC transporter (see citation below), equivalent to Q9CBQ7|ML1726 putative ABC transporter protein ATP-binding protein from Mycobacterium leprae (305 aa), FASTA scores: opt: 1576, E(): 8.6e-85, (83.4% identity in 289 aa overlap). Also similar to other putative ATP-binding proteins ABC transporters e.g. Q9X9Z4|SCI5.06C from Streptomyces coelicolor (265 aa), FASTA scores: opt: 893, E(): 4.8e-45, (53.3% identity in 257 aa overlap); Q9L156|SC5C11.16c from Streptomyces coelicolor (279 aa), FASTA scores: opt: 680, E(): 1.3e-32, (45.4% identity in 271 aa overlap); etc. Contains PS00017 ATP/GTP-binding site motif A (P-loop). Belongs to the ATP-binding transport protein family (ABC transporters).
Functional categoryCell wall and cell processes
ProteomicsIdentified by mass spectrometry in whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv and CDC1551 strains (see Sassetti et al., 2003 and Lamichhane et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS34010553401918-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3041c|3401055-3401918|-|Rv3041c|downstream:0|upstream:0
atgcggcacgatagtcgggtgctcgacaacggcggccctgatgcggctgaccccgacctgctgatcgacttccgaaacgtgtccctgcgccgtaatgggcgcacgctggtcggcccgctggattgggcggtcgaactcgacgaacgctgggtgatcgtcggccccaacggggccggcaagacgtcattgctgcgcattgccgccgcggctgagcatccgtcgtcgggggtggcctttgtgctcggtgagcggctaggccgggttgacgtctcggaactgcgtgctcgggtcgggctcagttcctcggcgctggcggagcgggtgcccggcgacgaacgcgtccgcgatcttgtcgtctccgccggctatgcagtgttgggccggtggcgcgagcgctacgaggccgtcgactaccaccgcgcgatcgacatgctggagagcctgggcgctgagcatttggccaaccgcacatacggaacactgtcggagggcgagcgcaagcgagtgctgattgcgcgggctttgatgacagatccagagctgctgctgctcgacgaacccgccgccggcctggacttaggtggccgagaggaattggtcgcccggctggccgacctggcagccgaccctgacgcgcccgcgctggttctggtcacccaccacgtcgaggagattccgcccggcttcagccattgcctgctgctgtcggaggcccgggtggttgccgcgggcttgcttcccgacgcgctgaccgccgagaacctgtccaccgcgtttggccaggagatcacgctggaggtggccgacgggcgatatttcgcccgacggcgtcgcagccgagcagcccatcggagacagtcatga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3041c|Rv3041c
MRHDSRVLDNGGPDAADPDLLIDFRNVSLRRNGRTLVGPLDWAVELDERWVIVGPNGAGKTSLLRIAAAAEHPSSGVAFVLGERLGRVDVSELRARVGLSSSALAERVPGDERVRDLVVSAGYAVLGRWRERYEAVDYHRAIDMLESLGAEHLANRTYGTLSEGERKRVLIARALMTDPELLLLDEPAAGLDLGGREELVARLADLAADPDAPALVLVTHHVEEIPPGFSHCLLLSEARVVAAGLLPDALTAENLSTAFGQEITLEVADGRYFARRRRSRAAHRRQS