Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionUnknown
ProductESX-1 secretion-associated protein EspK. Alanine and proline rich protein.
CommentsRv3879c, (MTV027.14c), len: 729 aa. EspK, ESX-1 secretion-associated protein, ala- and pro-rich protein (N-terminal end is repetitive and highly Proline-rich). There may be an unknown protein Orf14 encoded in the opposite orientation, within rv3879c (See Ahmad et al., 1999; Daugelat et al., 2003).
Functional categoryCell wall and cell processes
ProteomicsIdentified in the cell membrane fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in M. tuberculosis H37Rv-infected guinea pig lungs at 90 days but not 30 days (See Kruh et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). Translational start site supported by proteomics data (See Kelkar et al., 2011).
TranscriptomicsmRNA identified by RT-PCR (See Amoudy et al., 2006).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Disruption of this gene provides a growth advantage for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in CDC1551 strain (see Lamichhane et al., 2003).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS43575934359782-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3879c|4357593-4359782|-|espK|downstream:0|upstream:0
atgagtattaccaggccgacgggcagctatgccagacagatgctggatccgggcggctgggtggaagccgatgaagacactttctatgaccgggcccaggaatatagccaggttttgcaaagggtcaccgatgtattggacacctgccgccagcagaaaggccacgtcttcgaaggcggcctatggtccggcggcgccgccaatgctgccaacggcgccctgggtgcaaacatcaatcaattgatgacgctgcaggattatctcgccacggtgattacctggcacaggcatattgccgggttgattgagcaagctaaatccgatatcggcaataatgtggatggcgctcaacgggagatcgatatcctggagaatgaccctagcctggatgctgatgagcgccataccgccatcaattcattggtcacggcgacgcatggggccaatgtcagtctggtcgccgagaccgctgagcgggtgctggaatccaagaattggaaacctccgaagaacgcactcgaggatttgcttcagcagaagtcgccgccacccccagacgtgcctaccctggtcgtgccatccccgggcacaccgggcacaccgggaaccccgatcaccccgggaaccccgatcaccccgggaaccccaatcacacccatcccgggagcgccggtaactccgatcacaccaacgcccggcactcccgtcacgccggtgaccccgggcaagccggtcaccccggtgaccccggtcaaaccgggcacaccaggcgagccaaccccgatcacgccggtcacccccccggtcgccccggccacaccggcaaccccggccacgcccgttaccccagctcccgctccacacccgcagccggctccggcaccggcgccatcgcctgggccccagccggttacaccggccactcccggtccgtctggtccagcaacaccgggcaccccagggggcgagccggcgccgcacgtcaaacccgcggcgttggcggagcaacctggtgtgccgggccagcatgcgggcggggggacgcagtcggggcctgcccatgcggacgaatccgccgcgtcggtgacgccggctgcggcgtccggtgtcccgggcgcacgggcggcggccgccgcgccgagcggtaccgccgtgggagcgggcgcgcgttcgagcgtgggtacggccgcggcctcgggcgcggggtcgcatgctgccactgggcgggcgccggtggctacctcggacaaggcggcggcaccgagcacgcgggcggcctcggcgcggacggcacctcctgcccgcccgccgtcgaccgatcacatcgacaaacccgatcgcagcgagtctgcagatgacggtacgccggtgtcgatgatcccggtgtcggcggctcgggcggcacgcgacgccgccactgcagctgccagcgcccgccagcgtggccgcggtgatgcgctgcggttggcgcgacgcatcgcggcggcgctcaacgcgtccgacaacaacgcgggcgactacgggttcttctggatcaccgcggtgaccaccgacggttccatcgtcgtggccaacagctatgggctggcctacatacccgacgggatggaattgccgaataaggtgtacttggccagcgcggatcacgcaatcccggttgacgaaattgcacgctgtgccacctacccggttttggccgtgcaagcctgggcggctttccacgacatgacgctgcgggcggtgatcggtaccgcggagcagttggccagttcggatcccggtgtggccaagattgtgctggagccagatgacattccggagagcggcaaaatgacgggccggtcgcggctggaggtcgtcgacccctcggcggcggctcagctggccgacactaccgatcagcgtttgctcgacttgttgccgccggcgccggtggatgtcaatccaccgggcgatgagcggcacatgctgtggttcgagctgatgaagcccatgaccagcaccgctaccggccgcgaggccgctcatctgcgggcgttccgggcctacgctgcccactcacaggagattgccctgcaccaagcgcacactgcgactgacgcggccgtccagcgtgtggccgtcgcggactggctgtactggcaatacgtcaccgggttgctcgaccgggccctggccgccgcatgctga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3879c|espK
MSITRPTGSYARQMLDPGGWVEADEDTFYDRAQEYSQVLQRVTDVLDTCRQQKGHVFEGGLWSGGAANAANGALGANINQLMTLQDYLATVITWHRHIAGLIEQAKSDIGNNVDGAQREIDILENDPSLDADERHTAINSLVTATHGANVSLVAETAERVLESKNWKPPKNALEDLLQQKSPPPPDVPTLVVPSPGTPGTPGTPITPGTPITPGTPITPIPGAPVTPITPTPGTPVTPVTPGKPVTPVTPVKPGTPGEPTPITPVTPPVAPATPATPATPVTPAPAPHPQPAPAPAPSPGPQPVTPATPGPSGPATPGTPGGEPAPHVKPAALAEQPGVPGQHAGGGTQSGPAHADESAASVTPAAASGVPGARAAAAAPSGTAVGAGARSSVGTAAASGAGSHAATGRAPVATSDKAAAPSTRAASARTAPPARPPSTDHIDKPDRSESADDGTPVSMIPVSAARAARDAATAAASARQRGRGDALRLARRIAAALNASDNNAGDYGFFWITAVTTDGSIVVANSYGLAYIPDGMELPNKVYLASADHAIPVDEIARCATYPVLAVQAWAAFHDMTLRAVIGTAEQLASSDPGVAKIVLEPDDIPESGKMTGRSRLEVVDPSAAAQLADTTDQRLLDLLPPAPVDVNPPGDERHMLWFELMKPMTSTATGREAAHLRAFRAYAAHSQEIALHQAHTATDAAVQRVAVADWLYWQYVTGLLDRALAAAC
      
Bibliography