Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionFunction unknown
ProductConserved hypothetical protein
CommentsRv3896c, (MTCY15F10.16), len: 302 aa (first GTG taken, although TBParse suggests TTG at 16079). Putative conserved ala-rich protein. C-terminus highly similar to C-terminal end of other proteins e.g. Q9XAS4|SC10A7.01 hypothetical 17.2 KDA protein from Streptomyces coelicolor (244 aa), FASTA scores: opt: 255, E(): 1.4e-08, (32.0% identity in 222 aa overlap); CAC44611|STBAC16H6.32 putative secreted protein from Streptomyces coelicolor (172 aa), FASTA scores: opt: 214, E(): 3.4e-06, (42.55% identity in 94 aa overlap); Q38352|ORF360 from Lactococcus delbrueckii bacteriophage ll-H (360 aa), FASTA scores: opt: 211, E(): 9.5e-06, (40.0% identity in 115 aa overlap); P54334|XKDO_BACSU|XKDO phage-like element PBSX protein from Bacillus subtilis (1332 aa), FASTA scores: opt: 209, E(): 3.6e-05, (38.35% identity in 86 aa overlap); etc. Also similar to P71594|P71594|Rv0024|MTCY10H4.24 hypothetical 30.3 KDA protein from Mycobacterium tuberculosis (281 aa), FASTA scores: opt: 265, E(): 3.9e-09, (29.25% identity in 287 aa overlap).
Functional categoryConserved hypotheticals
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS43819434382851-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3896c|4381943-4382851|-|Rv3896c|downstream:0|upstream:0
gtgagcacatggcacaggattggcaccgaaggcgaacccttgactgatcccctgaccacgcaggcgatagcggcgctgtcccggggccacggcctgttcgcgggcggcgtttccggcgccgacatcgacgcgccgcagatccagcagtatgcgaacgcgatatcctgggtggccaacgccgttcccaccgcagcggcgtaccgctggcgcggcgccgcaagagcgctgcgtcgattggccaacaccgatgaggcgctggcccagatcatggcggcagcccagatcgatcatgcgcacgccaggaccgcgacgcgtgcactcctggaagccgccaagaccgatgccatggccttgaccgacacaccgctgggccggcgggaggcgatggcccggatggccgcccggctgcgggctcagcatcggcacatcgcgcgatgtaggtcgcgggcgcggctattggggctgcggctgcgccggctgcgctacctgcgcaccgccgcggcaagacgaccccaggtaaccacacccggtggacgcgcccaagtgttggcggcgatccaaaaagcgttggatatccaaggcgttcacgatccagccgcgcgggcacgctggactcgcggcatggacctggtggcccgtcgcgaatcgaactacaacgccaacgccataaaccactgggattccaacgccgcgcggggcacccccagcaggggcgtctggcagttcatcgctccgacgttcgcggcctatcacgagccgggcacgtcgaccaacatccacgatttggtcgcccaggcatgcgcgttcatcaactacgcgagaggccactacggggtggccgccgacgcatcgaatctggccgatctgatccagcaggccgatcctcgccgcagccccagggggtattga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3896c|Rv3896c
VSTWHRIGTEGEPLTDPLTTQAIAALSRGHGLFAGGVSGADIDAPQIQQYANAISWVANAVPTAAAYRWRGAARALRRLANTDEALAQIMAAAQIDHAHARTATRALLEAAKTDAMALTDTPLGRREAMARMAARLRAQHRHIARCRSRARLLGLRLRRLRYLRTAAARRPQVTTPGGRAQVLAAIQKALDIQGVHDPAARARWTRGMDLVARRESNYNANAINHWDSNAARGTPSRGVWQFIAPTFAAYHEPGTSTNIHDLVAQACAFINYARGHYGVAADASNLADLIQQADPRRSPRGY