Gene Rv3896c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown |
Product | Conserved hypothetical protein |
Comments | Rv3896c, (MTCY15F10.16), len: 302 aa (first GTG taken, although TBParse suggests TTG at 16079). Putative conserved ala-rich protein. C-terminus highly similar to C-terminal end of other proteins e.g. Q9XAS4|SC10A7.01 hypothetical 17.2 KDA protein from Streptomyces coelicolor (244 aa), FASTA scores: opt: 255, E(): 1.4e-08, (32.0% identity in 222 aa overlap); CAC44611|STBAC16H6.32 putative secreted protein from Streptomyces coelicolor (172 aa), FASTA scores: opt: 214, E(): 3.4e-06, (42.55% identity in 94 aa overlap); Q38352|ORF360 from Lactococcus delbrueckii bacteriophage ll-H (360 aa), FASTA scores: opt: 211, E(): 9.5e-06, (40.0% identity in 115 aa overlap); P54334|XKDO_BACSU|XKDO phage-like element PBSX protein from Bacillus subtilis (1332 aa), FASTA scores: opt: 209, E(): 3.6e-05, (38.35% identity in 86 aa overlap); etc. Also similar to P71594|P71594|Rv0024|MTCY10H4.24 hypothetical 30.3 KDA protein from Mycobacterium tuberculosis (281 aa), FASTA scores: opt: 265, E(): 3.9e-09, (29.25% identity in 287 aa overlap). |
Functional category | Conserved hypotheticals |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 4381943 | 4382851 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3896c|4381943-4382851|-|Rv3896c|downstream:0|upstream:0 gtgagcacatggcacaggattggcaccgaaggcgaacccttgactgatcccctgaccacgcaggcgatagcggcgctgtcccggggccacggcctgttcgcgggcggcgtttccggcgccgacatcgacgcgccgcagatccagcagtatgcgaacgcgatatcctgggtggccaacgccgttcccaccgcagcggcgtaccgctggcgcggcgccgcaagagcgctgcgtcgattggccaacaccgatgaggcgctggcccagatcatggcggcagcccagatcgatcatgcgcacgccaggaccgcgacgcgtgcactcctggaagccgccaagaccgatgccatggccttgaccgacacaccgctgggccggcgggaggcgatggcccggatggccgcccggctgcgggctcagcatcggcacatcgcgcgatgtaggtcgcgggcgcggctattggggctgcggctgcgccggctgcgctacctgcgcaccgccgcggcaagacgaccccaggtaaccacacccggtggacgcgcccaagtgttggcggcgatccaaaaagcgttggatatccaaggcgttcacgatccagccgcgcgggcacgctggactcgcggcatggacctggtggcccgtcgcgaatcgaactacaacgccaacgccataaaccactgggattccaacgccgcgcggggcacccccagcaggggcgtctggcagttcatcgctccgacgttcgcggcctatcacgagccgggcacgtcgaccaacatccacgatttggtcgcccaggcatgcgcgttcatcaactacgcgagaggccactacggggtggccgccgacgcatcgaatctggccgatctgatccagcaggccgatcctcgccgcagccccagggggtattga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3896c|Rv3896c VSTWHRIGTEGEPLTDPLTTQAIAALSRGHGLFAGGVSGADIDAPQIQQYANAISWVANAVPTAAAYRWRGAARALRRLANTDEALAQIMAAAQIDHAHARTATRALLEAAKTDAMALTDTPLGRREAMARMAARLRAQHRHIARCRSRARLLGLRLRRLRYLRTAAARRPQVTTPGGRAQVLAAIQKALDIQGVHDPAARARWTRGMDLVARRESNYNANAINHWDSNAARGTPSRGVWQFIAPTFAAYHEPGTSTNIHDLVAQACAFINYARGHYGVAADASNLADLIQQADPRRSPRGY
Bibliography
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant