Gene Rv0260c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Could be involved in transcriptional mechanism. |
Product | Possible transcriptional regulatory protein |
Comments | Rv0260c, (MTCY0A4.04c), len: 381 aa. Possible two-component response regulator, highly similar to CAB72204.1|AL138851 putative transcriptional regulator from Streptomyces coelicolor (395 aa); and similar to O34394|D69851|YJJA conserved hypothetical protein from Bacillus subtilis (270 aa), FASTA scores: opt: 312, E(): 7.4e-14, (25.8% identity in 267 aa overlap). Also some similarity to regulatory proteins at C-terminal region e.g. CUTR_STRLI|Q03756 transcriptional regulatory protein (217 aa), FASTA scores: opt: 138, E(): 0.02, (30.6% identity in 111 aa overlap). |
Functional category | Regulatory proteins |
Proteomics | Identified in the cell wall fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Translational start site supported by proteomics data (See Kelkar et al., 2011). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv and CDC1551 strains (see Sassetti et al., 2003 and Lamichhane et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 311514 | 312659 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0260c|311514-312659|-|Rv0260c|downstream:0|upstream:0 atggcccaggcacactcggcgccactgaccggctaccggatcgcggtgacatccgctcgccgcgccgaagagctgtgcgcattgcttcgccgccagggcgccgaggtctgtagtgccccagcgatcaagatgatcgcgcttcccgacgacgatgaactgcagaacaacaccgaggcgttgatcgccgacccgcctgacattctggtcgcccacaccggcatcggatttcgcggctggttggccgcggccgaggggtgggggctggccaacgagctcctggaatcgttgtcgtcggcccggatcatctcccgcggaccaaaggcaactggtgcgctgcgtgccgccggcctgcgtgaagagtggtcccccgactctgaatcgtcgcatgaagtgctggaatatctgctcgaatcgggggtgtcccgtacgcgtattgccgtccagctgcacggtgccgccgacagctgggacccgtttccggaatttctgggcgggttacgtttcgccggcgcgcaagtggtgccgatccgggtttaccggtggaagccggcgccactaggcggcgtgttcgaccatttagtcaccgggatcgcgcgacgacaattcgacgcggtcaccttcacgtcggcacctgccgcagccgcggtgctagaacgcagccgtgaattggatatcgaggaccaactgttggctgcgctgcgtaccgacgtgcacgcgatgtgtgtcggcccggtaacttcgcggccgttgatccgaaagggcgtcccgacgtcggctcccgagcgaatgcggttgggagccttagcccgccacattgccgaggagctgccgctgctgggttcgtgcacgttcaaagcagccggccacgtgatcgagatccgtggaacctctgtgctggtggatgattcggtgaagccactatcgccgtccggaatggcgattttgcgcgcgttggtacatcgccccggcggcgtcgtctctcgtggcgacttgctacgcgtcctacccggcgacggcagcgacacccacgccgtggacaccgccgtcctgcggctacgaacggctctgggcgacaagaacatcgtggcaacagtggtgaaacgtggctaccgtctcgccgttgacagccggcacgatgacgtatga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0260c|Rv0260c MAQAHSAPLTGYRIAVTSARRAEELCALLRRQGAEVCSAPAIKMIALPDDDELQNNTEALIADPPDILVAHTGIGFRGWLAAAEGWGLANELLESLSSARIISRGPKATGALRAAGLREEWSPDSESSHEVLEYLLESGVSRTRIAVQLHGAADSWDPFPEFLGGLRFAGAQVVPIRVYRWKPAPLGGVFDHLVTGIARRQFDAVTFTSAPAAAAVLERSRELDIEDQLLAALRTDVHAMCVGPVTSRPLIRKGVPTSAPERMRLGALARHIAEELPLLGSCTFKAAGHVIEIRGTSVLVDDSVKPLSPSGMAILRALVHRPGGVVSRGDLLRVLPGDGSDTHAVDTAVLRLRTALGDKNIVATVVKRGYRLAVDSRHDDV
Bibliography
- Lamichhane G et al. [2003]. A postgenomic method for predicting essential genes at subsaturation levels of mutagenesis: application to Mycobacterium tuberculosis. Mutant
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Kelkar DS et al. [2011]. Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry. Proteomics Sequence
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant