Gene Rv0456c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Could possibly oxidize fatty acids using specific components [catalytic activity: (3S)-3-hydroxyacyl-CoA = trans-2(or 3)-enoyl-CoA + H(2)O]. |
Product | enoyl-CoA hydratase EchA2 (enoyl hydrase) (unsaturated acyl-CoA hydratase) (crotonase) |
Comments | Rv0456c, (MTCI429A.02, MTV037.20c), len: 304 aa. Probable echA2, enoyl-CoA hydratase, similar to other enoyl-CoA hydratases e.g. Q13011 peroxisomal enoyl-CoA hydratase-like protein (328 aa), FASTA scores: opt: 209, E(): 5.3e-07, (31.7% identity in 142 aa overlap). Also similar to several other proteins from Mycobacterium tuberculosis e.g. MTCY09F9.29 FASTA score: (32.9% identity in 146 aa overlap); and MTI376.01c. |
Functional category | Lipid metabolism |
Proteomics | Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 545889 | 546803 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0456c|545889-546803|-|echA2|downstream:0|upstream:0 atgccgacacccgatttccagacgctgctgtacacgacggccgggccggtggccaccatcacgctcaaccgcccggaacagctcaacaccatcgtcccgcccatgcccgacgagatcgaggccgctatcgggttggccgagcgcgaccaggacatcaaggtcatcgtgctgcgcggtgccggccgcgccttctccggcggttacgacttcggcggcggcttccagcattggggcgatgccatgatgaccgacggccgatgggatccgggcaaggatttcgccatggtcaccgcgcgggagaccggaccgacgcagaaattcatggccatctggcgggcgtccaaaccggtgatcgcgcaagtgcatggttggtgcgtcggcggggccagcgactacgcgctgtgtgccgacattgtgatcgccagcgaggacgccgtgatcgggactccgtatagccgcatgtggggagcctatttgaccgggatgtggctgtatcgactcagccttgccaaggtcaaatggcactcgctgacgggccggccgctgaccggtgtgcaggccgccgaagccgagctgatcaacgaggcggtgccgttcgagcggctcgaggctcgcgtcgccgagatcgccaccgagctggcacgaatcccgttgtcacagttgcaagcccagaaactgatcgtcaaccaggcctacgagaacatgggcctggcctccacccagctgctgggcggcattctcgacgggctgatgcgcaacacccccgacgcgctcgagttcatccggaccgcccaaacccagggtgtgcgagccgcggtcgagcgccgcgacggcccgttcggcgactacagccaagccccaccggaactgcgacccgaccccacgcacgtcatcactcctgatgggagcatgtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0456c|echA2 MPTPDFQTLLYTTAGPVATITLNRPEQLNTIVPPMPDEIEAAIGLAERDQDIKVIVLRGAGRAFSGGYDFGGGFQHWGDAMMTDGRWDPGKDFAMVTARETGPTQKFMAIWRASKPVIAQVHGWCVGGASDYALCADIVIASEDAVIGTPYSRMWGAYLTGMWLYRLSLAKVKWHSLTGRPLTGVQAAEAELINEAVPFERLEARVAEIATELARIPLSQLQAQKLIVNQAYENMGLASTQLLGGILDGLMRNTPDALEFIRTAQTQGVRAAVERRDGPFGDYSQAPPELRPDPTHVITPDGSM
Bibliography
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant