Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionCould possibly oxidize fatty acids using specific components [catalytic activity: (3S)-3-hydroxyacyl-CoA = trans-2(or 3)-enoyl-CoA + H(2)O].
Productenoyl-CoA hydratase EchA2 (enoyl hydrase) (unsaturated acyl-CoA hydratase) (crotonase)
CommentsRv0456c, (MTCI429A.02, MTV037.20c), len: 304 aa. Probable echA2, enoyl-CoA hydratase, similar to other enoyl-CoA hydratases e.g. Q13011 peroxisomal enoyl-CoA hydratase-like protein (328 aa), FASTA scores: opt: 209, E(): 5.3e-07, (31.7% identity in 142 aa overlap). Also similar to several other proteins from Mycobacterium tuberculosis e.g. MTCY09F9.29 FASTA score: (32.9% identity in 146 aa overlap); and MTI376.01c.
Functional categoryLipid metabolism
ProteomicsIdentified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS545889546803-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0456c|545889-546803|-|echA2|downstream:0|upstream:0
atgccgacacccgatttccagacgctgctgtacacgacggccgggccggtggccaccatcacgctcaaccgcccggaacagctcaacaccatcgtcccgcccatgcccgacgagatcgaggccgctatcgggttggccgagcgcgaccaggacatcaaggtcatcgtgctgcgcggtgccggccgcgccttctccggcggttacgacttcggcggcggcttccagcattggggcgatgccatgatgaccgacggccgatgggatccgggcaaggatttcgccatggtcaccgcgcgggagaccggaccgacgcagaaattcatggccatctggcgggcgtccaaaccggtgatcgcgcaagtgcatggttggtgcgtcggcggggccagcgactacgcgctgtgtgccgacattgtgatcgccagcgaggacgccgtgatcgggactccgtatagccgcatgtggggagcctatttgaccgggatgtggctgtatcgactcagccttgccaaggtcaaatggcactcgctgacgggccggccgctgaccggtgtgcaggccgccgaagccgagctgatcaacgaggcggtgccgttcgagcggctcgaggctcgcgtcgccgagatcgccaccgagctggcacgaatcccgttgtcacagttgcaagcccagaaactgatcgtcaaccaggcctacgagaacatgggcctggcctccacccagctgctgggcggcattctcgacgggctgatgcgcaacacccccgacgcgctcgagttcatccggaccgcccaaacccagggtgtgcgagccgcggtcgagcgccgcgacggcccgttcggcgactacagccaagccccaccggaactgcgacccgaccccacgcacgtcatcactcctgatgggagcatgtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0456c|echA2
MPTPDFQTLLYTTAGPVATITLNRPEQLNTIVPPMPDEIEAAIGLAERDQDIKVIVLRGAGRAFSGGYDFGGGFQHWGDAMMTDGRWDPGKDFAMVTARETGPTQKFMAIWRASKPVIAQVHGWCVGGASDYALCADIVIASEDAVIGTPYSRMWGAYLTGMWLYRLSLAKVKWHSLTGRPLTGVQAAEAELINEAVPFERLEARVAEIATELARIPLSQLQAQKLIVNQAYENMGLASTQLLGGILDGLMRNTPDALEFIRTAQTQGVRAAVERRDGPFGDYSQAPPELRPDPTHVITPDGSM