Gene Rv0678
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown |
Product | Conserved protein |
Comments | Rv0678, (MTV040.06), len: 165 aa. Conserved protein, showing weak similarity with AL049754|SCH10_10 hypothetical protein from Streptomyces coelicolor (152 aa), FASTA scores: opt: 149, E(): 0.0018, (22.9% identity in 140 aa overlap). |
Functional category | Conserved hypotheticals |
Proteomics | Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). |
Transcriptomics | mRNA identified by microarray analysis and down-regulated after 4h of starvation (see citation below). DNA microarrays and qRT-PCR show higher expression of Rv0676c, Rv0677c and Rv0678 in azole-resistant H37Rv mutant than in wild-type (See Milano et al., 2009). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Azole-resistant H37Rv mutant has mutations in Rv0678 (See Milano et al., 2009). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 778990 | 779487 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0678|778990-779487|+|Rv0678|downstream:0|upstream:0 gtgagcgtcaacgacggggtcgatcagatgggcgccgagcccgacatcatggaattcgtcgaacagatgggcggctatttcgagtccaggagtttgactcggttggcgggtcgattgttgggctggctgctggtgtgtgatcccgagcggcagtcctcggaggaactggcgacggcgctggcggccagcagcggggggatcagcaccaatgcccggatgctgatccaatttgggttcattgagcggctcgcggtcgccggggatcggcgcacctatttccggttgcggcccaacgctttcgcggctggcgagcgtgaacgcatccgggcaatggccgaactgcaggacctggctgacgtggggctgagggcgctgggcgacgccccgccgcagcgaagccgacggctgcgggagatgcgggatctgttggcatatatggagaacgtcgtctccgacgccctggggcgatacagccagcgaaccggagaggacgactga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0678|Rv0678 VSVNDGVDQMGAEPDIMEFVEQMGGYFESRSLTRLAGRLLGWLLVCDPERQSSEELATALAASSGGISTNARMLIQFGFIERLAVAGDRRTYFRLRPNAFAAGERERIRAMAELQDLADVGLRALGDAPPQRSRRLREMRDLLAYMENVVSDALGRYSQRTGEDD
Bibliography
- Betts JC et al. [2002]. Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Transcriptome
- Milano A et al. [2009]. Azole resistance in Mycobacterium tuberculosis is mediated by the MmpS5-MmpL5 efflux system. Mutant Transcriptome
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- Mazandu GK et al. [2012]. Function prediction and analysis of mycobacterium tuberculosis hypothetical proteins. Function
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant