Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionFunction unknown
ProductConserved protein
CommentsRv0678, (MTV040.06), len: 165 aa. Conserved protein, showing weak similarity with AL049754|SCH10_10 hypothetical protein from Streptomyces coelicolor (152 aa), FASTA scores: opt: 149, E(): 0.0018, (22.9% identity in 140 aa overlap).
Functional categoryConserved hypotheticals
ProteomicsIdentified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011).
TranscriptomicsmRNA identified by microarray analysis and down-regulated after 4h of starvation (see citation below). DNA microarrays and qRT-PCR show higher expression of Rv0676c, Rv0677c and Rv0678 in azole-resistant H37Rv mutant than in wild-type (See Milano et al., 2009).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Azole-resistant H37Rv mutant has mutations in Rv0678 (See Milano et al., 2009).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS778990779487+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0678|778990-779487|+|Rv0678|downstream:0|upstream:0
gtgagcgtcaacgacggggtcgatcagatgggcgccgagcccgacatcatggaattcgtcgaacagatgggcggctatttcgagtccaggagtttgactcggttggcgggtcgattgttgggctggctgctggtgtgtgatcccgagcggcagtcctcggaggaactggcgacggcgctggcggccagcagcggggggatcagcaccaatgcccggatgctgatccaatttgggttcattgagcggctcgcggtcgccggggatcggcgcacctatttccggttgcggcccaacgctttcgcggctggcgagcgtgaacgcatccgggcaatggccgaactgcaggacctggctgacgtggggctgagggcgctgggcgacgccccgccgcagcgaagccgacggctgcgggagatgcgggatctgttggcatatatggagaacgtcgtctccgacgccctggggcgatacagccagcgaaccggagaggacgactga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0678|Rv0678
VSVNDGVDQMGAEPDIMEFVEQMGGYFESRSLTRLAGRLLGWLLVCDPERQSSEELATALAASSGGISTNARMLIQFGFIERLAVAGDRRTYFRLRPNAFAAGERERIRAMAELQDLADVGLRALGDAPPQRSRRLREMRDLLAYMENVVSDALGRYSQRTGEDD