Gene Rv1519
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown |
Product | Conserved hypothetical protein |
Comments | Rv1519, (MTCY19G5.09c), len: 89 aa. Conserved hypothetical protein, high similarity to C-terminus of Q50723|MTCY78.26|Rv3402c (412 aa) (58.1% identity in 74 aa overlap). |
Functional category | Conserved hypotheticals |
Transcriptomics | DNA microarrays indicate repression by iron and IdeR|Rv2711 in M. tuberculosis H37Rv (See Rodriguez et al., 2002). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 1710733 | 1711002 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv1519|1710733-1711002|+|Rv1519|downstream:0|upstream:0 ttgcgttgtggttgcctcgcatgcgacggagtgctctgcgccaacggcccaggtcgtccgagaaggccagccttgacctgtacagctgtggcgacccgaacgttgcacagcttggcgacgaatgccgagttggtcgagtcggccgatctgaccgtcaccgaggatatttgctcgcgaatcgtgtcgctgccagttcacgaccacatggccattgccgacgttgcgcgggtcgttgcgccgttcggggaagggttagcgcgcggtggttga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv1519|Rv1519 LRCGCLACDGVLCANGPGRPRRPALTCTAVATRTLHSLATNAELVESADLTVTEDICSRIVSLPVHDHMAIADVARVVAPFGEGLARGG
Bibliography
- Gold B et al. [2001]. The Mycobacterium tuberculosis IdeR is a dual functional regulator that controls transcription of genes involved in iron acquisition, iron storage and survival in macrophages. Regulon
- Rodriguez GM, Voskuil MI, Gold B, Schoolnik GK and Smith I [2002]. ideR, An essential gene in mycobacterium tuberculosis: role of IdeR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Transcriptome
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Prakash P et al. [2005]. Computational prediction and experimental verification of novel IdeR binding sites in the upstream sequences of Mycobacterium tuberculosis open reading frames. Regulon
- Manabe YC et al. [2005]. Both Corynebacterium diphtheriae DtxR(E175K) and Mycobacterium tuberculosis IdeR(D177K) are dominant positive repressors of IdeR-regulated genes in M. tuberculosis. Regulon
- Newton SM et al. [2006]. A deletion defining a common Asian lineage of Mycobacterium tuberculosis associates with immune subversion. Mutant
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- Mazandu GK et al. [2012]. Function prediction and analysis of mycobacterium tuberculosis hypothetical proteins. Function
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant