Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionPyrimidine biosynthesis (last step) [catalytic activity: ATP + UTP + glutamine = ADP + orthophosphate + CTP (ammonia can replace glutamine).]
ProductProbable CTP synthase PyrG
CommentsRv1699, (MTCI125.21), len: 586 aa. Probable pyrG, CTP synthase highly similar to many e.g. PYRG_ECOLI|P08398 ctp synthase from Escherichia coli (544 aa), FASTA scores: opt: 1786, E():0, (51.8% identity in 548 aa overlap). Contains PS00442 Glutamine amidotransferases class-I active site.
Functional categoryIntermediary metabolism and respiration
ProteomicsIdentified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011).
MutantEssential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS19238291925589+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv1699|1923829-1925589|+|pyrG|downstream:0|upstream:0
gtgcgaaagcacccgcaaaccgctaccaagcacctcttcgtcagcggcggcgttgcttcctcgctcggcaagggactgaccgccagcagcctaggacaattgttgacggctcgtgggttacacgtcacgatgcaaaagctcgacccgtacctcaacgtcgacccgggtaccatgaacccgttccagcacggcgaggtcttcgtgaccgaggacggtgccgaaaccgatctcgacgtcggccactacgaacggttcctcgatcgcaatttgcccggctcagcgaatgtgactaccgggcaggtgtattcaacggtgatcgcgaaggagcgccgcggcgaatacctgggcgacaccgtgcaggtgatcccccatatcaccgacgagataaaacggcgcatcctggcgatggcccaaccggacgccgacggtaaccgcccggacgtggtcatcaccgaaatcgggggcactgtcggcgatatcgagtcacagcccttcctggaggcagcgcggcaagtccggcactatctcggccgggaggacgtgttttttctgcacgtgtcgctggtgccctacctggcgccgtcgggtgagctcaaaaccaagccaacacagcactcggtggccgcactgcgcagcattgggattaccccggacgcgttgatcctgcgctgcgaccgcgacgttcccgaagcgctgaaaaacaagattgcgttgatgtgtgacgtcgatatcgacggcgttatctccaccccggacgcgccctccatctacgacatacccaaggtattgcaccgcgaggagctcgatgcgttcgtggtgcgccgactcaatctgccgttccgcgacgtcgattggaccgaatgggacgacctgctgcgccgggttcacgaaccacatgagacagtgcgaattgctttggtgggcaagtacgtcgaattatccgacgcttacctctcggttgccgaggcattgcgtgccggcggattcaagcaccgggccaaggtcgagatctgttgggtggcatccgacggttgtgaaacgaccagtggtgccgcggcggcgctcggcgatgtgcatggggtgctcattccgggcggattcggcatcaggggcatcgagggcaagatcggtgccattgcatacgcgcgggcgcgcgggttgccggtgttggggctgtgcctcggtttgcagtgcattgtgatcgaggccgcgcgatcggtcggtctcaccaacgccaattcggccgaatttgatcccgacacaccagatcccgttatcgccacgatgcccgatcaagaagaaatcgtggccggcgaggcggatctgggcggtaccatgcgtctcgggtcctaccccgccgtgttggagccggattcggttgttgcccaggcataccaaactacccaggtgtccgagcggcatcgccaccggtacgaggtcaacaacgcgtaccgagacaagatcgccgaaagcggcctgaggttttccgggacgtcacctgacggacacttggtagagttcgtcgagtatccgccggatcggcatccgttcgttgtcggcacccaggcccaccccgagttgaagagccgacccacccggccgcacccactgtttgtcgcattcgtcggggcagccatcgattacaaggcgggtgagttgctgcctgtcgagatccccgagatccccgagcacacacccaacggtagctcccatcgggacggcgtgggccagccgctaccggaacctgcgtctcgtggctga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv1699|pyrG
VRKHPQTATKHLFVSGGVASSLGKGLTASSLGQLLTARGLHVTMQKLDPYLNVDPGTMNPFQHGEVFVTEDGAETDLDVGHYERFLDRNLPGSANVTTGQVYSTVIAKERRGEYLGDTVQVIPHITDEIKRRILAMAQPDADGNRPDVVITEIGGTVGDIESQPFLEAARQVRHYLGREDVFFLHVSLVPYLAPSGELKTKPTQHSVAALRSIGITPDALILRCDRDVPEALKNKIALMCDVDIDGVISTPDAPSIYDIPKVLHREELDAFVVRRLNLPFRDVDWTEWDDLLRRVHEPHETVRIALVGKYVELSDAYLSVAEALRAGGFKHRAKVEICWVASDGCETTSGAAAALGDVHGVLIPGGFGIRGIEGKIGAIAYARARGLPVLGLCLGLQCIVIEAARSVGLTNANSAEFDPDTPDPVIATMPDQEEIVAGEADLGGTMRLGSYPAVLEPDSVVAQAYQTTQVSERHRHRYEVNNAYRDKIAESGLRFSGTSPDGHLVEFVEYPPDRHPFVVGTQAHPELKSRPTRPHPLFVAFVGAAIDYKAGELLPVEIPEIPEHTPNGSSHRDGVGQPLPEPASRG