Gene Rv2782c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown; possibly hydrolyzes peptides and/or proteins |
Product | Probable zinc protease PepR |
Comments | Rv2782c, (MTV002.47c), len: 438 aa. Probable pepR, protease/peptidase, equivalent to O32965|YR82_MYCLE|ML0855|MLCB22.26c hypothetical zinc protease from Mycobacterium leprae (445 aa), FASTA scores: opt: 2346, E(): 4.3e-146, (84.3% identity in 421 aa overlap). Also highly similar to others e.g. O86835|YA12_STRCO|SC9A10.02 from Streptomyces coelicolor (459 aa), FASTA scores: opt: 1394, E(): 1.1e-83, (51.9% identity in 416 aa overlap); Q04805|YMXG_BACSU|YMXG from Bacillus subtilis (409 aa), FASTA scores: opt: 1014, E(): 7.9e-59, (37.55% identity in 410 aa overlap); Q9KA85|BH2405 from Bacillus halodurans (413 aa), FASTA scores: opt: 967, E(): 9.6e-56, (38.6% identity in 417 aa overlap); etc. Contains PS00143 Insulinase family, zinc-binding region signature. Belongs to peptidase family M16, also known as the insulinase family. Cofactor: requires divalent cations for activity. Binds zinc. Conserved in M. tuberculosis, M. leprae, M. bovis and M. avium paratuberculosis; predicted to be essential for in vivo survival and pathogenicity (See Ribeiro-Guimaraes and Pessolani, 2007). |
Functional category | Intermediary metabolism and respiration |
Proteomics | Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 3089045 | 3090361 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2782c|3089045-3090361|-|pepR|downstream:0|upstream:0 atgccgcgacggtcaccagctgaccccgcggcggcgctggcgccgcggcgcaccaccctgccgggcgggctgcgagtggtcaccgaattcctgcccgcggtgcactccgcgtcggtcggggtgtgggtcggcgtcggatcgcgcgacgaaggcgccacggtggccggggcggcgcacttccttgagcatttgctgttcaagtcgacgcccacccgctctgccgtggacattgcgcaggcgatggacgcggtgggcggggaactgaacgcattcaccgccaaggagcacacctgctactacgcccacgtgctcggcagcgacttgccgttggccgtcgacctggtcgccgatgtggtgctcaacggccgctgtgccgccgacgatgtcgaggtggaacgtgacgtcgtcctcgaggagatcgcgatgcgcgacgacgaccccgaggacgccttggcggacatgttcctggcggcgttgttcggcgaccacccggtcggtcgcccggtgatcggcagcgcgcaatccgtgtcggtgatgacgcgggctcaactgcaatcgtttcacctgcggcgctataccccggagcggatggtcgtcgcggccgccggcaatgtggatcacgacgggctggttgcgttggtccgcgagcacttcgggtcccggttggtccgggggagacggccagttgcgccgcgcaagggtaccggccgggtcaacggcagcccccggttgacactggttagccgcgacgccgaacagacgcatgtgtcgctgggcatccgcacacccgggcgcggctgggagcatcgttgggcactgtcggtgctgcacaccgcgctgggcggtggcttgagttcccggctgttccaggaggtccgcgagacccgcgggctggcctactcggtctactccgcgctggatctcttcgccgacagcggcgcgctttcggtgtacgcggcctgcctgcccgaacgcttcgccgacgtgatgcgggtgaccgccgatgtgctggaaagcgtggcacgcgacggcatcaccgaggcggaatgcggcatcgccaagggatcgctgcggggtgggctggtgctagggctggaggattccagctcccggatgagccggctcggccgcagcgagttgaactacggcaagcaccgcagcatcgaacacaccttgcggcaaatcgagcaggtcaccgtggaggaggtcaacgcggtggcccgccacctgctgagcaggcgctacggtgctgccgttcttggcccacacggatcgaaacgatcactgccgcaacaacttcgagcgatggtagggtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2782c|pepR MPRRSPADPAAALAPRRTTLPGGLRVVTEFLPAVHSASVGVWVGVGSRDEGATVAGAAHFLEHLLFKSTPTRSAVDIAQAMDAVGGELNAFTAKEHTCYYAHVLGSDLPLAVDLVADVVLNGRCAADDVEVERDVVLEEIAMRDDDPEDALADMFLAALFGDHPVGRPVIGSAQSVSVMTRAQLQSFHLRRYTPERMVVAAAGNVDHDGLVALVREHFGSRLVRGRRPVAPRKGTGRVNGSPRLTLVSRDAEQTHVSLGIRTPGRGWEHRWALSVLHTALGGGLSSRLFQEVRETRGLAYSVYSALDLFADSGALSVYAACLPERFADVMRVTADVLESVARDGITEAECGIAKGSLRGGLVLGLEDSSSRMSRLGRSELNYGKHRSIEHTLRQIEQVTVEEVNAVARHLLSRRYGAAVLGPHGSKRSLPQQLRAMVG
Bibliography
- Gu S et al. [2003]. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Proteomics
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Ribeiro-Guimarães ML et al. [2007]. Comparative genomics of mycobacterial proteases. Homology
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant