Gene Rv2807
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Function unknown |
Product | Conserved hypothetical protein |
Comments | Rv2807, (MTCY16B7.36c), len: 384 aa. Conserved hypothetical protein, highly similar, but shorter 35 aa, to Q9KK74 hypothetical 47.4 KDA protein from Brevibacterium linens (418 aa), FASTA scores: opt: 1865, E(): 9.4e-116, (69.75% identity in 380 aa overlap); and with similarity with other hypothetical proteins or transposases e.g. Q981U5|MLR9230 protein from Rhizobium loti (Mesorhizobium loti) (504 aa), FASTA scores: opt: 636,, (36.05% identity in 377 aa overlap); CAC47689 putative transposase for insertion sequence ISRM18 from Rhizobium meliloti (Sinorhizobium meliloti) (507 aa), FASTA scores: opt: 553, E(): 6.6e-29, (33.5% identity in 370 aa overlap); etc. Also similar to Rv3128c|MTCY164.38c (336 aa) (47.2% identity in 339 aa overlap); and high similarity at N-terminal region with Rv2805|MTCY16B7.38c (79.2% identity in 101 aa overlap). This region is a possible MT-complex-specific genomic island (See Becq et al., 2007). |
Functional category | Conserved hypotheticals |
Proteomics | Identified in the cell membrane fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). |
Mutant | Non-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Found to be deleted (partially or completely) in one or more clinical isolates (See Tsolaki et al., 2004). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 3113658 | 3114812 | + |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2807|3113658-3114812|+|Rv2807|downstream:0|upstream:0 gtggtgtccaccaccgggatgggtcgttcgacggcccggcggatgctgaccggcccggggctgccggagccggccgagcaggtcgacgggcgcaggctgcgggcgcggggcttcagtgacgacgccagggcgcttttagagcacgtgtgggccttgatgggcatgccgtgcggcaagtacctggtggtgatgctcgagctgtggctgccgcttgaggccgccgccggtgatcttgacaagccgttcgccaccgaagcggcggtggcggagttgaaggcgatgagcgcggccaccgtggaccgctacctcaaacccgcccgcgagcggatgcgcatcaaaggcatctcgacaaccaaaccctcaccattgctgcgtaattcgatcaccatccacacctgttcggatgaggcgcccaaggtcccgggggtgatcgaggccgacactgtggcgcactgcggcccgagtctaatcggcgagttcgcccgcaccctgacgatgactgatctggtgaccggctggaccgagaacgcctcgatccgcaacaacgcggccaagtggatcctcgagggcatcaaggagtgccagcagcggttcccattcccgatgacggttttcgattcggactgcgggggcgagttcatcaatcacgacgtcgccggctggctgcaggcccgcgacatcgcccagactcgctcgcggccgtaccagaagaacgaccaggcccatgtcgagtccaagaacaatcatgtggtgcgcaaacacgcgttctactggcgctatgacaccggcgaagagctggagctgctcaaccggctatggccgttggtgtcgctgcggtgcaacttcttcaccccgaccaaaaagcccgtcggctacaccagcaccgtcaacggtcgccgcaagcgcatctatgacaagccggccaccccatggcagcgcctgcaggcatcgggcgtccttgatgcacagcaactctcgaccgtggccgcccgaatcgaaggcttcaacccggccgatctgacccgccagatcaacgcgatccaaatgcagctgctcgacctggccaagaccaagaccgaggccctggccaccgcccgccacatcgacctgcaatcattgcaaccgtcaatcaaccgattggccaaggcgaagtaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2807|Rv2807 VVSTTGMGRSTARRMLTGPGLPEPAEQVDGRRLRARGFSDDARALLEHVWALMGMPCGKYLVVMLELWLPLEAAAGDLDKPFATEAAVAELKAMSAATVDRYLKPARERMRIKGISTTKPSPLLRNSITIHTCSDEAPKVPGVIEADTVAHCGPSLIGEFARTLTMTDLVTGWTENASIRNNAAKWILEGIKECQQRFPFPMTVFDSDCGGEFINHDVAGWLQARDIAQTRSRPYQKNDQAHVESKNNHVVRKHAFYWRYDTGEELELLNRLWPLVSLRCNFFTPTKKPVGYTSTVNGRRKRIYDKPATPWQRLQASGVLDAQQLSTVAARIEGFNPADLTRQINAIQMQLLDLAKTKTEALATARHIDLQSLQPSINRLAKAK
Bibliography
- Tsolaki AG, Hirsh AE, DeRiemer K, Enciso JA, Wong MZ, Hannan M, Goguet de la Salmoniere YO, Aman K, Kato-Maeda M and Small PM [2004]. Functional and evolutionary genomics of Mycobacterium tuberculosis: insights from genomic deletions in 100 strains. Mutant
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Becq J, Gutierrez MC, Rosas-Magallanes V, Rauzier J, Gicquel B, Neyrolles O and Deschavanne P [2007]. Contribution of horizontally acquired genomic islands to the evolution of the tubercle bacilli. Sequence
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant