Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionFunction unknown
ProductConserved hypothetical protein
CommentsRv2807, (MTCY16B7.36c), len: 384 aa. Conserved hypothetical protein, highly similar, but shorter 35 aa, to Q9KK74 hypothetical 47.4 KDA protein from Brevibacterium linens (418 aa), FASTA scores: opt: 1865, E(): 9.4e-116, (69.75% identity in 380 aa overlap); and with similarity with other hypothetical proteins or transposases e.g. Q981U5|MLR9230 protein from Rhizobium loti (Mesorhizobium loti) (504 aa), FASTA scores: opt: 636,, (36.05% identity in 377 aa overlap); CAC47689 putative transposase for insertion sequence ISRM18 from Rhizobium meliloti (Sinorhizobium meliloti) (507 aa), FASTA scores: opt: 553, E(): 6.6e-29, (33.5% identity in 370 aa overlap); etc. Also similar to Rv3128c|MTCY164.38c (336 aa) (47.2% identity in 339 aa overlap); and high similarity at N-terminal region with Rv2805|MTCY16B7.38c (79.2% identity in 101 aa overlap). This region is a possible MT-complex-specific genomic island (See Becq et al., 2007).
Functional categoryConserved hypotheticals
ProteomicsIdentified in the cell membrane fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Found to be deleted (partially or completely) in one or more clinical isolates (See Tsolaki et al., 2004).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS31136583114812+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2807|3113658-3114812|+|Rv2807|downstream:0|upstream:0
gtggtgtccaccaccgggatgggtcgttcgacggcccggcggatgctgaccggcccggggctgccggagccggccgagcaggtcgacgggcgcaggctgcgggcgcggggcttcagtgacgacgccagggcgcttttagagcacgtgtgggccttgatgggcatgccgtgcggcaagtacctggtggtgatgctcgagctgtggctgccgcttgaggccgccgccggtgatcttgacaagccgttcgccaccgaagcggcggtggcggagttgaaggcgatgagcgcggccaccgtggaccgctacctcaaacccgcccgcgagcggatgcgcatcaaaggcatctcgacaaccaaaccctcaccattgctgcgtaattcgatcaccatccacacctgttcggatgaggcgcccaaggtcccgggggtgatcgaggccgacactgtggcgcactgcggcccgagtctaatcggcgagttcgcccgcaccctgacgatgactgatctggtgaccggctggaccgagaacgcctcgatccgcaacaacgcggccaagtggatcctcgagggcatcaaggagtgccagcagcggttcccattcccgatgacggttttcgattcggactgcgggggcgagttcatcaatcacgacgtcgccggctggctgcaggcccgcgacatcgcccagactcgctcgcggccgtaccagaagaacgaccaggcccatgtcgagtccaagaacaatcatgtggtgcgcaaacacgcgttctactggcgctatgacaccggcgaagagctggagctgctcaaccggctatggccgttggtgtcgctgcggtgcaacttcttcaccccgaccaaaaagcccgtcggctacaccagcaccgtcaacggtcgccgcaagcgcatctatgacaagccggccaccccatggcagcgcctgcaggcatcgggcgtccttgatgcacagcaactctcgaccgtggccgcccgaatcgaaggcttcaacccggccgatctgacccgccagatcaacgcgatccaaatgcagctgctcgacctggccaagaccaagaccgaggccctggccaccgcccgccacatcgacctgcaatcattgcaaccgtcaatcaaccgattggccaaggcgaagtaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2807|Rv2807
VVSTTGMGRSTARRMLTGPGLPEPAEQVDGRRLRARGFSDDARALLEHVWALMGMPCGKYLVVMLELWLPLEAAAGDLDKPFATEAAVAELKAMSAATVDRYLKPARERMRIKGISTTKPSPLLRNSITIHTCSDEAPKVPGVIEADTVAHCGPSLIGEFARTLTMTDLVTGWTENASIRNNAAKWILEGIKECQQRFPFPMTVFDSDCGGEFINHDVAGWLQARDIAQTRSRPYQKNDQAHVESKNNHVVRKHAFYWRYDTGEELELLNRLWPLVSLRCNFFTPTKKPVGYTSTVNGRRKRIYDKPATPWQRLQASGVLDAQQLSTVAARIEGFNPADLTRQINAIQMQLLDLAKTKTEALATARHIDLQSLQPSINRLAKAK