Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionPossibly causes methylation of RNA.
ProductPossible RNA methyltransferase (RNA methylase)
CommentsRv0380c, (MTV036.15c), len: 183 aa. Possible RNA methyltransferase, equivalent to CAC32002.1|AL583925 possible RNA methyltransferase from Mycobacterium leprae (182 aa). Also some similarity with others methyltransferases e.g. P19396|TRMH_ECOLI|78514|JV0043 tRNA (guanosine-2'-O-)-methyltransferase (tRNA methyltransferase) from Escherichia coli (229 aa), FASTA scores: opt: 227, E(): 1.4e-09, (28.9% identity in 166 aa overlap). Also similar to Rv0881, Rv3579c, Rv1644 from Mycobacterium tuberculosis.
Functional categoryIntermediary metabolism and respiration
ProteomicsIdentified by mass spectrometry in whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS456268456819-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv0380c|456268-456819|-|Rv0380c|downstream:0|upstream:0
gtgttgttgcgcgacggcgatgctcgcaacgtcgtcgacgcctaccggtactggacccgagaggcgatcatcgccgacatcgatacgcgccgtcaccccttgcacgtggcgatcgagaacttcggacacgatgccaatatcggctcggtggtgcgcaccgccaatgcattcgccgtgcacaccgtgcacatcgtcgggcgtcggcggtggaatcggcgcggcgccatggtgaccgaccgctatcagcggttatgccaccacgacagcaccaccgggctgctggagttcgcggcgggcgccggcttgaccgtggtggcggtggacaacgtcccgggtgcggcgcgcctggagcagaccgcgttgccgcgggaatgcctgctgttattcggccaggaagggcccggcattaccgacgacgcccgtgccggcgcggcggtcacggtgtcgatcgcccagttcgggtcgacgcgaagcattaacgccggcgtggccgccggaatcgcgatgcacgcctggatacggcagcacgcggacctgggccgcgcctggtag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv0380c|Rv0380c
VLLRDGDARNVVDAYRYWTREAIIADIDTRRHPLHVAIENFGHDANIGSVVRTANAFAVHTVHIVGRRRWNRRGAMVTDRYQRLCHHDSTTGLLEFAAGAGLTVVAVDNVPGAARLEQTALPRECLLLFGQEGPGITDDARAGAAVTVSIAQFGSTRSINAGVAAGIAMHAWIRQHADLGRAW