Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionProtein degradation
ProductProteasome alpha subunit PrcA; assembles with beta subunit PrcB.
CommentsRv2109c, (MTCY261.05c), len: 248 aa. PrcA, proteasome alpha-type subunit 1. Conserved in M. tuberculosis, M. leprae, M. bovis and M. avium paratuberculosis; predicted to be essential for in vivo survival and pathogenicity (See Ribeiro-Guimaraes and Pessolani, 2007). prcBA genes encode a proteasome with broad substrate specificity (See Lin et al., 2006).
Functional categoryIntermediary metabolism and respiration
ProteomicsThe product of this CDS corresponds to spot 2109c identified in short term culture filtrate by proteomics at the Statens Serum Institute (Denmark) (see citations below). Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the culture supernatant of M. tuberculosis H37Rv using mass spectrometry (See Mattow et al., 2003). Identified in the cell wall fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). Translational start site supported by proteomics data (See de Souza et al., 2011) (See Kelkar et al., 2011).
MutantEssential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Proteasome encoded by prcBA genes is essential for persistence and optimal growth in mice; Silencing of prcBA results in increased susceptibility to reactive nitrogen intermediates stress and increased resistance to oxidative stress (See Gandotra et al., 2007).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS23689832369729-
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2109c|2368983-2369729|-|prcA|downstream:0|upstream:0
gtgagttttccgtatttcatctcgcctgagcaggcgatgcgcgagcgcagcgagttggcgcgtaagggcattgcgcgggccaaaagcgtggtggcgctggcctatgccggtggtgtgctgttcgtcgcggagaatccgtcgcggtcgctgcagaagatcagtgagctctacgatcgggtgggttttgcggctgcgggcaagttcaacgagttcgacaatttgcgccgcggcgggatccagttcgccgacacccgcggttacgcctatgaccgtcgtgacgtcacgggtcggcagttggccaatgtctacgcgcagactctaggcaccatcttcaccgaacaggccaagccctacgaggttgagttgtgtgtggccgaggtggcgcattacggcgagacgaaacgccctgagttgtatcgtattacctacgacgggtcgatcgccgacgagccgcatttcgtggtgatgggcggcaccacggagccgatcgccaacgcgctcaaagagtcgtatgccgagaacgccagcctgaccgacgccctgcgtatcgcggtcgctgcattgcgggccggcagtgccgacacctcgggtggtgatcaacccacccttggcgtggccagcttagaggtggccgttctcgatgccaaccggccacggcgcgcgttccggcgcatcaccggctccgccctgcaagcgttgctggtagaccaggaaagcccgcagtctgacggcgaatcgtcgggctga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2109c|prcA
VSFPYFISPEQAMRERSELARKGIARAKSVVALAYAGGVLFVAENPSRSLQKISELYDRVGFAAAGKFNEFDNLRRGGIQFADTRGYAYDRRDVTGRQLANVYAQTLGTIFTEQAKPYEVELCVAEVAHYGETKRPELYRITYDGSIADEPHFVVMGGTTEPIANALKESYAENASLTDALRIAVAALRAGSADTSGGDQPTLGVASLEVAVLDANRPRRAFRRITGSALQALLVDQESPQSDGESSG
      
Bibliography