Gene Rv2109c
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | Protein degradation |
Product | Proteasome alpha subunit PrcA; assembles with beta subunit PrcB. |
Comments | Rv2109c, (MTCY261.05c), len: 248 aa. PrcA, proteasome alpha-type subunit 1. Conserved in M. tuberculosis, M. leprae, M. bovis and M. avium paratuberculosis; predicted to be essential for in vivo survival and pathogenicity (See Ribeiro-Guimaraes and Pessolani, 2007). prcBA genes encode a proteasome with broad substrate specificity (See Lin et al., 2006). |
Functional category | Intermediary metabolism and respiration |
Proteomics | The product of this CDS corresponds to spot 2109c identified in short term culture filtrate by proteomics at the Statens Serum Institute (Denmark) (see citations below). Identified in the membrane fraction of M. tuberculosis H37Rv using 1D-SDS-PAGE and uLC-MS/MS (See Gu et al., 2003). Identified in the culture supernatant of M. tuberculosis H37Rv using mass spectrometry (See Mattow et al., 2003). Identified in the cell wall fraction of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified by mass spectrometry in Triton X-114 extracts of M. tuberculosis H37Rv (See Malen et al., 2010). Identified by mass spectrometry in the membrane protein fraction and whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate (See de Souza et al., 2011). Translational start site supported by proteomics data (See de Souza et al., 2011) (See Kelkar et al., 2011). |
Mutant | Essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Proteasome encoded by prcBA genes is essential for persistence and optimal growth in mice; Silencing of prcBA results in increased susceptibility to reactive nitrogen intermediates stress and increased resistance to oxidative stress (See Gandotra et al., 2007). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 2368983 | 2369729 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv2109c|2368983-2369729|-|prcA|downstream:0|upstream:0 gtgagttttccgtatttcatctcgcctgagcaggcgatgcgcgagcgcagcgagttggcgcgtaagggcattgcgcgggccaaaagcgtggtggcgctggcctatgccggtggtgtgctgttcgtcgcggagaatccgtcgcggtcgctgcagaagatcagtgagctctacgatcgggtgggttttgcggctgcgggcaagttcaacgagttcgacaatttgcgccgcggcgggatccagttcgccgacacccgcggttacgcctatgaccgtcgtgacgtcacgggtcggcagttggccaatgtctacgcgcagactctaggcaccatcttcaccgaacaggccaagccctacgaggttgagttgtgtgtggccgaggtggcgcattacggcgagacgaaacgccctgagttgtatcgtattacctacgacgggtcgatcgccgacgagccgcatttcgtggtgatgggcggcaccacggagccgatcgccaacgcgctcaaagagtcgtatgccgagaacgccagcctgaccgacgccctgcgtatcgcggtcgctgcattgcgggccggcagtgccgacacctcgggtggtgatcaacccacccttggcgtggccagcttagaggtggccgttctcgatgccaaccggccacggcgcgcgttccggcgcatcaccggctccgccctgcaagcgttgctggtagaccaggaaagcccgcagtctgacggcgaatcgtcgggctga
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv2109c|prcA VSFPYFISPEQAMRERSELARKGIARAKSVVALAYAGGVLFVAENPSRSLQKISELYDRVGFAAAGKFNEFDNLRRGGIQFADTRGYAYDRRDVTGRQLANVYAQTLGTIFTEQAKPYEVELCVAEVAHYGETKRPELYRITYDGSIADEPHFVVMGGTTEPIANALKESYAENASLTDALRIAVAALRAGSADTSGGDQPTLGVASLEVAVLDANRPRRAFRRITGSALQALLVDQESPQSDGESSG
Bibliography
- Rosenkrands I et al. [2000]. Towards the proteome of Mycobacterium tuberculosis. Proteomics
- Rosenkrands I, Weldingh K, Jacobsen S, Hansen CV, Florio W, Gianetri I and Andersen P [2000]. Mapping and identification of Mycobacterium tuberculosis proteins by two-dimensional gel electrophoresis, microsequencing and immunodetection. Proteomics
- Gu S et al. [2003]. Comprehensive proteomic profiling of the membrane constituents of a Mycobacterium tuberculosis strain. Proteomics
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Mattow J, Schaible UE, Schmidt F, Hagens K, Siejak F, Brestrich G, Haeselbarth G, Muller EC, Jungblut PR and Kaufmann SH [2003]. Comparative proteome analysis of culture supernatant proteins from virulent Mycobacterium tuberculosis H37Rv and attenuated M. bovis BCG Copenhagen. Proteomics
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Lin G et al. [2006]. Mycobacterium tuberculosis prcBA genes encode a gated proteasome with broad oligopeptide specificity. Function Product
- Hu G et al. [2006]. Structure of the Mycobacterium tuberculosis proteasome and mechanism of inhibition by a peptidyl boronate. Structure
- Gandotra S et al. [2007]. In vivo gene silencing identifies the Mycobacterium tuberculosis proteasome as essential for the bacteria to persist in mice. Mutant
- Ribeiro-Guimarães ML et al. [2007]. Comparative genomics of mycobacterial proteases. Homology
- Målen H et al. [2010]. Definition of novel cell envelope associated proteins in Triton X-114 extracts of Mycobacterium tuberculosis H37Rv. Proteomics
- Kelkar DS et al. [2011]. Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry. Proteomics Sequence
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- de Souza GA et al. [2011]. Proteogenomic analysis of polymorphisms and gene annotation divergences in prokaryotes using a clustered mass spectrometry-friendly database. Proteomics Sequence
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant