Go to browser
virulence, detoxification, adaptation
information pathways
cell wall and cell processes
stable RNAs
insertion seqs and phages
PE/PPE
intermediary metabolism and respiration
unknown
regulatory proteins
conserved hypotheticals
lipid metabolism
pseudogenes
General annotation
TypeCDS
FunctionInvolved in a transcriptional mechanism.
ProductProbable transcriptional regulatory protein (probably MerR-family)
CommentsRv3334, (MTV016.34), len: 146 aa. Probable transcriptional regulator, similar to many regulatory proteins (notably mercury resistance operon regulators) e.g. Q9HXV1|PA3689 probable transcriptional regulator MerR family from Pseudomonas aeruginosa (156 aa), FASTA scores: opt: 275, E(): 1.6e-11, (35.95% identity in 139 aa overlap); Q9AKR6|PBRR lead resistance operon regulator from Ralstonia metallidurans strain CH34 (plasmid pMOL30) (145 aa), FASTA scores: opt: 267, E(): 5.2e-11, (35.8% identity in 134 aa overlap); P95838|MERR mercuric resistance operon regulator from Synechococcus sp. strain PCC 7942 (Anacystis nidulans R2) (144 aa), FASTA scores: opt: 266, E(): 6e-11, (31.35% identity in 118 aa overlap); P22853|MERR_BACSR mercuric resistance operon regulator from Bacillus sp. strain RC607 (132 aa), FASTA scores: opt: 262, E(): 1e-10, (34.6% identity in 130 aa overlap); etc. Contains probable helix-turn-helix motif at aa 1-22 (Score 1478, +4.22 SD). Seems to belong to the MerR family of transcriptional regulators.
Functional categoryRegulatory proteins
ProteomicsIdentified by mass spectrometry in whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011).
TranscriptomicsmRNA identified by DNA microarray analysis and up-regulated at high temperatures, and up-regulated after 24h of starvation (see citations below). DNA microarrays show lower level of expression in M. tuberculosis H37Rv during Mg2+ starvation (See Walters et al., 2006).
MutantNon-essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Non-essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Non essential gene by Himar1 transposon mutagenesis in H37Rv and CDC1551 strains (see Sassetti et al., 2003 and Lamichhane et al., 2003). Non-essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011).
Check for mutants available at TARGET website
Coordinates
TypeStartEndOrientation
CDS37212573721697+
Genomic sequence
Feature type Upstream flanking region (bp) Downstream flanking region (bp) Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3334|3721257-3721697|+|Rv3334|downstream:0|upstream:0
atgaagatcagcgaggtagccgcgctcaccaacaccagcaccaagaccctccgcttctacgagaactcggggctgctgccgccgcctgcacgcacagcatcggggtatcgcaactatggacccgagatcgtggatcggctgcggtttatccatcggggccaagcggccgggctggcattacaggaagtacgccaaatcctggccatccacgaccgcggcgaggcgccgtgcgcacacgtccgccaactactgagcacccgcatcgacgaagtccgcgcgcagatcgccgaactgattgccctcgaaggccacttgcagaccctgcttgaccacgcttcatatggcccgcccaccgaacacgaccactccacggtgtgttggatcctggaaagcgacctcgatgagcccaccgccatcgaggtcagcgacattcacgcctag
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3334|Rv3334
MKISEVAALTNTSTKTLRFYENSGLLPPPARTASGYRNYGPEIVDRLRFIHRGQAAGLALQEVRQILAIHDRGEAPCAHVRQLLSTRIDEVRAQIAELIALEGHLQTLLDHASYGPPTEHDHSTVCWILESDLDEPTAIEVSDIHA