Gene Rv3014c (lig)
in Mycobacterium tuberculosis H37Rv
General annotation
Type | CDS |
Function | This protein catalyzes the formation of phosphodiester linkages between 5'-phosphoryl and 3'-hydroxyl groups in double-stranded DNA using NAD as a coenzyme and as the energy source for the reaction. It is essential for DNA replication and repair of damaged DNA [catalytic activity: NAD(+) + (deoxyribonucleotide)(N) + (deoxyribonucleotide)(M) = AMP + nicotinamide nucleotide + (deoxyribonucleotide)(N+M)]. |
Product | DNA ligase [NAD dependent] LigA (polydeoxyribonucleotide synthase [NAD+]) |
Comments | Rv3014c, (MT3094, MTV012.28c), len: 691 aa. ligA (alternate gene name: lig), DNA ligase NAD-dependent (see citation below), equivalent to O33102|DNLJ_MYCLE|LIGA|LIG|ML1705|MLCB637.10 DNA ligase from Mycobacterium leprae (694 aa), FASTA scores: opt: 3844, E(): 0, (84.7% identity in 687 aa overlap). Also highly similar to many prokaryotic and eukaryotic ligases e.g. Q9Z585|LIGA|SC8D9.06 from Streptomyces coelicolor (735 aa), FASTA scores: opt: 2002, E(): 4e-113, (59.4% identity in 714 aa overlap); P49421|DNLJ_RHOMR|LIGA|LIG from Rhodothermus marinus (712 aa), FASTA scores: opt: 1835, E(): 4.6e-103, (45.55% identity in 685 aa overlap); P15042|DNLJ_ECOLI|LIGA|LIG|DNAL|PDEC|lop|B2411 from Escherichia coli strain K12 (671 aa), FASTA scores: opt: 1696, E(): 1.1e-94, (43.8% identity in 680 aa overlap); etc. Belongs to the NAD-dependent DNA ligase family. |
Functional category | Information pathways |
Proteomics | Identified in the cytosol, cell wall, and cell membrane fractions of M. tuberculosis H37Rv using 2DLC/MS (See Mawuenyega et al., 2005). Identified by mass spectrometry in whole cell lysates of M. tuberculosis H37Rv but not the culture filtrate or membrane protein fraction (See de Souza et al., 2011). Translational start site supported by proteomics data (See Kelkar et al., 2011). |
Mutant | Essential gene for in vitro growth of H37Rv in a MtbYM rich medium, by Himar1 transposon mutagenesis (see Minato et al. 2019). Essential gene for in vitro growth of H37Rv, by analysis of saturated Himar1 transposon libraries (see DeJesus et al. 2017). Essential gene by Himar1 transposon mutagenesis in H37Rv strain (see Sassetti et al., 2003). Essential gene for in vitro growth of H37Rv, by Himar1 transposon mutagenesis (See Griffin et al., 2011). Check for mutants available at TARGET website |
Coordinates
Type | Start | End | Orientation |
---|---|---|---|
CDS | 3372545 | 3374620 | - |
Genomic sequence
Feature type
Upstream flanking region (bp)
Downstream flanking region (bp)
Update
>Mycobacterium tuberculosis H37Rv|CDS|Rv3014c|3372545-3374620|-|ligA|downstream:0|upstream:0 gtgagctccccagacgccgatcagaccgctcccgaggtgttgcggcagtggcaggcactggccgaggaggtgcgtgagcaccagttccgttattacgtgcgggacgcgccgatcatcagcgacgcggaattcgacgagctgctgcgccgtctggaagccctcgaggagcagcatcccgagctgcgcacgcccgattcgccgacccagctggtcggcggtgccggcttcgccacggatttcgagcccgtcgaccatctcgaacgaatgctcagcctcgacaacgcgttcaccgccgacgaactcgccgcctgggccggccgcatccatgccgaggtcggagacgccgcacattacctgtgtgagctcaagatcgacggcgtcgcgctgtctttggtctaccgcgagggacggctgacccgggcctccacccgcggcgacgggcgcaccggcgaggacgtcaccctgaacgcccggaccatcgccgacgttcccgaacggctcacccccggcgacgactacccggtgcccgaggtcctcgaggtccgcggcgaggtcttcttccggctggacgacttccaggcgctcaacgccagcctcgtcgaggagggcaaggcgccgttcgccaacccccgcaacagcgcggcgggatcgctgcgccagaaagacccggcggtcaccgcgcgccgccggctgcggatgatctgccacgggctgggccacgtggagggctttcgcccggccaccctgcatcaggcatacctggcgttgcgggcatggggactgccggtttccgaacacaccaccctggcaaccgacctggccggtgtgcgcgagcgcatcgactactggggcgagcaccgccacgaggtggaccacgaaatcgacggcgtggtggtcaaagtcgacgaggtggcgttgcagcgcaggctgggttccacgtcgcgggcgccgcgctgggccatcgcctacaagtacccgcccgaggaagcgcagaccaagctgctcgacatccgggtgaacgtcggccgcaccgggcggatcacgccgtttgcgttcatgacgccggtgaaggtggccgggtcgacggtgggacaggccaccctgcacaacgcctcggagatcaagcgcaagggcgtgctgatcggcgacaccgtggtgatccgcaaggccggcgacgtgatccccgaggtgctgggacccgtcgtcgaactgcgcgatggctccgaacgcgaattcatcatgcccaccacctgcccggagtgcggttcgccgttggcgccggagaaggaaggcgacgccgacatccgttgccccaacgcccgcggctgcccggggcaactgcgggagcgggttttccacgtcgccagccgcaacggcctagacatcgaggtgctcggttacgaggcgggtgtggcgctcttgcaggcgaaggtgatcgccgacgagggcgagctgttcgcgctgaccgagcgggacttgctgcgcaccgacctgttccgaaccaaggcaggcgaactgtcggccaacggcaaacggctgctggtcaacctcgacaaggccaaggcggcaccgctgtggcgggtgctggtggcgctgtccatccgccatgtcgggccgacggcggcccgcgccctggccaccgagttcggcagccttgacgccatcgccgcggcgtccaccgaccagctggccgccgtcgagggggtggggccgaccattgccgccgcggtcaccgagtggttcgccgtcgactggcaccgcgagatcgtcgacaagtggcgggccgccggggtgcgaatggtcgacgagcgtgacgagagtgtgccacgcacgctggccgggctgaccatcgtggtcaccggctcgctgaccggtttctcccgcgacgacgccaaggaggcgatcgtggcccgcggcggcaaggccgccggctcggtgtcgaagaagaccaactatgtcgtcgccggagactcgccgggatccaaatacgacaaggcggtggagttgggggtgccgattctggacgaggatgggttccggagactgctggccgacggacccgcgtcacgaacgtaa
Protein sequence
>Mycobacterium tuberculosis H37Rv|Rv3014c|ligA VSSPDADQTAPEVLRQWQALAEEVREHQFRYYVRDAPIISDAEFDELLRRLEALEEQHPELRTPDSPTQLVGGAGFATDFEPVDHLERMLSLDNAFTADELAAWAGRIHAEVGDAAHYLCELKIDGVALSLVYREGRLTRASTRGDGRTGEDVTLNARTIADVPERLTPGDDYPVPEVLEVRGEVFFRLDDFQALNASLVEEGKAPFANPRNSAAGSLRQKDPAVTARRRLRMICHGLGHVEGFRPATLHQAYLALRAWGLPVSEHTTLATDLAGVRERIDYWGEHRHEVDHEIDGVVVKVDEVALQRRLGSTSRAPRWAIAYKYPPEEAQTKLLDIRVNVGRTGRITPFAFMTPVKVAGSTVGQATLHNASEIKRKGVLIGDTVVIRKAGDVIPEVLGPVVELRDGSEREFIMPTTCPECGSPLAPEKEGDADIRCPNARGCPGQLRERVFHVASRNGLDIEVLGYEAGVALLQAKVIADEGELFALTERDLLRTDLFRTKAGELSANGKRLLVNLDKAKAAPLWRVLVALSIRHVGPTAARALATEFGSLDAIAAASTDQLAAVEGVGPTIAAAVTEWFAVDWHREIVDKWRAAGVRMVDERDESVPRTLAGLTIVVTGSLTGFSRDDAKEAIVARGGKAAGSVSKKTNYVVAGDSPGSKYDKAVELGVPILDEDGFRRLLADGPASRT
Bibliography
- Mizrahi V et al. [1998]. DNA repair in Mycobacterium tuberculosis. What have we learnt from the genome sequence? Secondary Function
- Sassetti CM et al. [2003]. Genes required for mycobacterial growth defined by high density mutagenesis. Mutant
- Gong C et al. [2004]. Biochemical and genetic analysis of the four DNA ligases of mycobacteria. Biochemistry Function
- Mawuenyega KG et al. [2005]. Mycobacterium tuberculosis functional network analysis by global subcellular protein profiling. Proteomics
- Srivastava SK et al. [2005]. NAD+-dependent DNA Ligase (Rv3014c) from Mycobacterium tuberculosis. Crystal structure of the adenylation domain and identification of novel inhibitors. Structure
- Srivastava SK et al. [2007]. NAD+-dependent DNA ligase (Rv3014c) from Mycobacterium tuberculosis: novel structure-function relationship and identification of a specific inhibitor. Biochemistry Structure
- Korycka-Machala M et al. [2007]. Evaluation of NAD(+) -dependent DNA ligase of mycobacteria as a potential target for antibiotics. Mutant
- Kelkar DS et al. [2011]. Proteogenomic analysis of Mycobacterium tuberculosis by high resolution mass spectrometry. Proteomics Sequence
- de Souza GA et al. [2011]. Bacterial proteins with cleaved or uncleaved signal peptides of the general secretory pathway. Proteomics
- Griffin JE et al. [2011]. High-resolution phenotypic profiling defines genes essential for mycobacterial growth and cholesterol catabolism. Mutant
- DeJesus MA et al. [2017]. Comprehensive Essentiality Analysis of the Mycobacterium tuberculosis Genome via Saturating Transposon Mutagenesis. Mutant
- Minato Y et al. [2019]. Genomewide Assessment of Mycobacterium tuberculosis Conditionally Essential Metabolic Pathways. Mutant